Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACK3B6_RS02145 Genome accession   NZ_CP176792
Coordinates   427368..427490 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus halotolerans strain BCP32     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 422368..432490
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACK3B6_RS02130 (ACK3B6_02130) yclJ 423970..424653 (+) 684 WP_024120210.1 two-component system response regulator YclJ -
  ACK3B6_RS02135 (ACK3B6_02135) - 424640..426064 (+) 1425 WP_202853231.1 sensor histidine kinase -
  ACK3B6_RS02140 (ACK3B6_02140) rapC 426236..427384 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  ACK3B6_RS02145 (ACK3B6_02145) phrC 427368..427490 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  ACK3B6_RS02150 (ACK3B6_02150) - 427596..427688 (-) 93 WP_083504413.1 YjcZ family sporulation protein -
  ACK3B6_RS02155 (ACK3B6_02155) - 427835..427945 (-) 111 WP_024120215.1 YjcZ family sporulation protein -
  ACK3B6_RS02160 (ACK3B6_02160) - 428097..429461 (-) 1365 WP_059291959.1 aspartate kinase -
  ACK3B6_RS02165 (ACK3B6_02165) ceuB 429846..430796 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  ACK3B6_RS02170 (ACK3B6_02170) yclO 430789..431736 (+) 948 WP_202853232.1 petrobactin ABC transporter permease YclO -
  ACK3B6_RS02175 (ACK3B6_02175) yclP 431730..432488 (+) 759 WP_202853233.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=1082969 ACK3B6_RS02145 WP_024120213.1 427368..427490(+) (phrC) [Bacillus halotolerans strain BCP32]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1082969 ACK3B6_RS02145 WP_024120213.1 427368..427490(+) (phrC) [Bacillus halotolerans strain BCP32]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875

Multiple sequence alignment