Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AACH71_RS10710 Genome accession   NZ_AP029050
Coordinates   2114797..2114919 (-) Length   40 a.a.
NCBI ID   WP_014662771.1    Uniprot ID   A0A292GN16
Organism   Bacillus stercoris strain BST19     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2109797..2119919
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AACH71_RS10685 (BSB_20780) yclP 2110056..2110814 (-) 759 WP_014662775.1 petrobactin ABC transporter ATP-binding protein YclP -
  AACH71_RS10690 (BSB_20790) yclO 2110808..2111755 (-) 948 WP_040084169.1 petrobactin ABC transporter permease YclO -
  AACH71_RS10695 (BSB_20800) ceuB 2111748..2112698 (-) 951 WP_040084171.1 petrobactin ABC transporter permease YclN Machinery gene
  AACH71_RS10700 (BSB_20810) - 2113083..2114447 (+) 1365 WP_136654856.1 aspartate kinase -
  AACH71_RS10705 - 2114590..2114700 (+) 111 WP_040084173.1 YjcZ family sporulation protein -
  AACH71_RS10710 (BSB_20820) phrC 2114797..2114919 (-) 123 WP_014662771.1 phosphatase RapC inhibitor PhrC Regulator
  AACH71_RS10715 (BSB_20830) rapC 2114903..2116051 (-) 1149 WP_014662770.1 response regulator aspartate phosphatase RapC Regulator
  AACH71_RS10720 (BSB_20840) yclK 2116214..2117635 (-) 1422 WP_136654857.1 two-component system sensor histidine kinase YclK -
  AACH71_RS10725 (BSB_20850) yclJ 2117622..2118305 (-) 684 WP_041521471.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4221.02 Da        Isoelectric Point: 8.0579

>NTDB_id=108269 AACH71_RS10710 WP_014662771.1 2114797..2114919(-) (phrC) [Bacillus stercoris strain BST19]
MKLKSKLFVICLAAAAIFTAAGVSAHAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=108269 AACH71_RS10710 WP_014662771.1 2114797..2114919(-) (phrC) [Bacillus stercoris strain BST19]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTCATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A292GN16

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975

Multiple sequence alignment