Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACK2WG_RS02130 Genome accession   NZ_CP176536
Coordinates   431546..431668 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii strain 29-4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 426546..436668
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACK2WG_RS02115 (ACK2WG_02115) yclJ 428161..428844 (+) 684 WP_003224983.1 two-component system response regulator YclJ -
  ACK2WG_RS02120 (ACK2WG_02120) yclK 428831..430252 (+) 1422 WP_409509433.1 two-component system sensor histidine kinase YclK -
  ACK2WG_RS02125 (ACK2WG_02125) rapC 430414..431562 (+) 1149 WP_014112649.1 response regulator aspartate phosphatase RapC Regulator
  ACK2WG_RS02130 (ACK2WG_02130) phrC 431546..431668 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACK2WG_RS02135 (ACK2WG_02135) - 431767..431874 (-) 108 WP_071578333.1 YjcZ family sporulation protein -
  ACK2WG_RS02140 (ACK2WG_02140) - 432027..433391 (-) 1365 WP_088680298.1 aspartate kinase -
  ACK2WG_RS02145 (ACK2WG_02145) ceuB 433777..434727 (+) 951 WP_061186190.1 petrobactin ABC transporter permease YclN Machinery gene
  ACK2WG_RS02150 (ACK2WG_02150) yclO 434720..435667 (+) 948 WP_014112652.1 petrobactin ABC transporter permease YclO -
  ACK2WG_RS02155 (ACK2WG_02155) yclP 435661..436419 (+) 759 WP_014112653.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1080751 ACK2WG_RS02130 WP_003224994.1 431546..431668(+) (phrC) [Bacillus spizizenii strain 29-4]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1080751 ACK2WG_RS02130 WP_003224994.1 431546..431668(+) (phrC) [Bacillus spizizenii strain 29-4]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCCGCTAATGC
GGAAGCACTCGACTTCCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment