Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AABJ90_RS18570 Genome accession   NZ_AP028964
Coordinates   3617140..3617262 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain NA05 = NBRC 116153     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3612140..3622262
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AABJ90_RS18540 (BsubNA05_35850) yclP 3612212..3612970 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  AABJ90_RS18545 (BsubNA05_35860) yclO 3612964..3613911 (-) 948 WP_338382220.1 petrobactin ABC transporter permease YclO -
  AABJ90_RS18550 (BsubNA05_35870) ceuB 3613904..3614854 (-) 951 WP_262120201.1 petrobactin ABC transporter permease YclN Machinery gene
  AABJ90_RS18555 (BsubNA05_35880) thrD 3615239..3616603 (+) 1365 WP_338382221.1 aspartate kinase -
  AABJ90_RS18560 yczN 3616756..3616869 (+) 114 WP_032728921.1 YjcZ family sporulation protein -
  AABJ90_RS18565 yczM 3616951..3617040 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AABJ90_RS18570 (BsubNA05_35890) phrC 3617140..3617262 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AABJ90_RS18575 (BsubNA05_35900) rapC 3617246..3618394 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  AABJ90_RS18580 (BsubNA05_35910) yclK 3618557..3619978 (-) 1422 WP_134818942.1 two-component system sensor histidine kinase YclK -
  AABJ90_RS18585 (BsubNA05_35920) yclJ 3619965..3620648 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=107618 AABJ90_RS18570 WP_003224994.1 3617140..3617262(-) (phrC) [Bacillus subtilis strain NA05 = NBRC 116153]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=107618 AABJ90_RS18570 WP_003224994.1 3617140..3617262(-) (phrC) [Bacillus subtilis strain NA05 = NBRC 116153]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
AGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment