Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACF2JY_RS18395 Genome accession   NZ_CP172966
Coordinates   3531438..3531560 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain cel     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3526438..3536560
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACF2JY_RS18365 (ACF2JY_18365) yclP 3526509..3527267 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  ACF2JY_RS18370 (ACF2JY_18370) yclO 3527261..3528208 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACF2JY_RS18375 (ACF2JY_18375) ceuB 3528201..3529151 (-) 951 WP_038428356.1 petrobactin ABC transporter permease YclN Machinery gene
  ACF2JY_RS18380 (ACF2JY_18380) thrD 3529536..3530900 (+) 1365 WP_038428355.1 aspartate kinase -
  ACF2JY_RS18385 (ACF2JY_18385) yczN 3531054..3531167 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACF2JY_RS18390 (ACF2JY_18390) yczM 3531249..3531338 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACF2JY_RS18395 (ACF2JY_18395) phrC 3531438..3531560 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACF2JY_RS18400 (ACF2JY_18400) rapC 3531544..3532692 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ACF2JY_RS18405 (ACF2JY_18405) yclK 3532856..3534277 (-) 1422 WP_082098066.1 two-component system sensor histidine kinase YclK -
  ACF2JY_RS18410 (ACF2JY_18410) yclJ 3534264..3534947 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1069742 ACF2JY_RS18395 WP_003224994.1 3531438..3531560(-) (phrC) [Bacillus subtilis strain cel]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1069742 ACF2JY_RS18395 WP_003224994.1 3531438..3531560(-) (phrC) [Bacillus subtilis strain cel]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment