Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACFMPA_RS02265 Genome accession   NZ_CP172605
Coordinates   434977..435099 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. SG20032     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 429977..440099
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACFMPA_RS02250 (ACFMPA_02250) yclJ 431591..432274 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ACFMPA_RS02255 (ACFMPA_02255) yclK 432261..433682 (+) 1422 WP_213414881.1 HAMP domain-containing sensor histidine kinase -
  ACFMPA_RS02260 (ACFMPA_02260) rapC 433845..434993 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  ACFMPA_RS02265 (ACFMPA_02265) phrC 434977..435099 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACFMPA_RS02270 (ACFMPA_02270) - 435199..435288 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACFMPA_RS02275 (ACFMPA_02275) - 435370..435483 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACFMPA_RS02280 (ACFMPA_02280) - 435636..437000 (-) 1365 WP_326224553.1 aspartate kinase -
  ACFMPA_RS02285 (ACFMPA_02285) ceuB 437385..438335 (+) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  ACFMPA_RS02290 (ACFMPA_02290) yclO 438328..439275 (+) 948 WP_326224555.1 petrobactin ABC transporter permease YclO -
  ACFMPA_RS02295 (ACFMPA_02295) yclP 439269..440027 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1068194 ACFMPA_RS02265 WP_003224994.1 434977..435099(+) (phrC) [Bacillus sp. SG20032]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1068194 ACFMPA_RS02265 WP_003224994.1 434977..435099(+) (phrC) [Bacillus sp. SG20032]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment