Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ACCO40_RS02200 Genome accession   NZ_CP167793
Coordinates   451481..451603 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii strain SHT-15     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 446481..456603
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACCO40_RS02185 (ACCO40_02185) yclJ 448096..448779 (+) 684 WP_014112647.1 two-component system response regulator YclJ -
  ACCO40_RS02190 (ACCO40_02190) yclK 448766..450187 (+) 1422 WP_072565741.1 two-component system sensor histidine kinase YclK -
  ACCO40_RS02195 (ACCO40_02195) rapC 450349..451497 (+) 1149 WP_014112649.1 response regulator aspartate phosphatase RapC Regulator
  ACCO40_RS02200 (ACCO40_02200) phrC 451481..451603 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACCO40_RS02205 (ACCO40_02205) - 451702..451809 (-) 108 WP_061186188.1 YjcZ family sporulation protein -
  ACCO40_RS02210 (ACCO40_02210) - 451962..453326 (-) 1365 WP_072181732.1 aspartate kinase -
  ACCO40_RS02215 (ACCO40_02215) ceuB 453712..454662 (+) 951 WP_061186190.1 petrobactin ABC transporter permease YclN Machinery gene
  ACCO40_RS02220 (ACCO40_02220) yclO 454655..455602 (+) 948 WP_014112652.1 petrobactin ABC transporter permease YclO -
  ACCO40_RS02225 (ACCO40_02225) yclP 455596..456354 (+) 759 WP_014112653.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1039390 ACCO40_RS02200 WP_003224994.1 451481..451603(+) (phrC) [Bacillus spizizenii strain SHT-15]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1039390 ACCO40_RS02200 WP_003224994.1 451481..451603(+) (phrC) [Bacillus spizizenii strain SHT-15]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCTGCGATTTTTACAGCGGCTGGCGTTTCCGCTAATGC
GGAAGCACTCGACTTCCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment