Detailed information NTG1038979

Bioinformatically predicted

Overview

• Name: pilB
• Type: Machinery gene
• Locus tag: ACCP96_RS05205
• Genome accession: NZ_CP167226
• Coordinates: 1245206..1245325 (+)
• Length: 39 a.a.
• NCBI ID: WP_136732873.1
• Uniprot ID: -
• Organism: Xanthomonas campestris pv. fici strain NCPPB 3886
• Function: power the assembly of type IV pilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
IScluster/Tn	1245440..1246542	1245206..1245325	flank	115

Gene organization within MGE regions

Location: 1245206..1246542

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
ACCP96_RS05205 (ACCP96_05205)	pilB	1245206..1245325 (+)	120	WP_136732873.1	pilus assembly protein	Machinery gene

Sequence

Protein

• Length: 39 a.a.
• Molecular weight: 4166.87 Da
• Isoelectric Point: 11.0375

>NTDB_id=1038979 ACCP96_RS05205 WP_136732873.1 1245206..1245325(+) (pilB) [Xanthomonas campestris pv. fici strain NCPPB 3886]
MKIASATQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide

• Length: 120 bp

>NTDB_id=1038979 ACCP96_RS05205 WP_136732873.1 1245206..1245325(+) (pilB) [Xanthomonas campestris pv. fici strain NCPPB 3886]
ATGAAGATCGCCAGCGCCACGCAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCCTTGATGAAGGCTGCCCACGGGGT
GACCAGCCTGGCCGAGATCAATCGGGTGACCAAGGACTAA

Domains

No domain identified.

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilB	Acinetobacter baumannii D1279779	48.718	100	0.487
pilB	Acinetobacter baylyi ADP1	48.718	100	0.487