Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   AB8O67_RS13530 Genome accession   NZ_CP166053
Coordinates   2578413..2578586 (+) Length   57 a.a.
NCBI ID   WP_024122036.1    Uniprot ID   -
Organism   Bacillus halotolerans strain XYK2-4     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2573413..2583586
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB8O67_RS13515 (AB8O67_13520) gcvT 2574210..2575298 (-) 1089 WP_326139069.1 glycine cleavage system aminomethyltransferase GcvT -
  AB8O67_RS13520 (AB8O67_13525) - 2575742..2577415 (+) 1674 WP_059293610.1 DEAD/DEAH box helicase -
  AB8O67_RS13525 (AB8O67_13530) - 2577435..2578229 (+) 795 WP_044154602.1 YqhG family protein -
  AB8O67_RS13530 (AB8O67_13535) sinI 2578413..2578586 (+) 174 WP_024122036.1 anti-repressor SinI Regulator
  AB8O67_RS13535 (AB8O67_13540) sinR 2578620..2578955 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  AB8O67_RS13540 (AB8O67_13545) tasA 2579042..2579827 (-) 786 WP_059293609.1 biofilm matrix protein TasA -
  AB8O67_RS13545 (AB8O67_13550) sipW 2579892..2580476 (-) 585 WP_059293608.1 signal peptidase I SipW -
  AB8O67_RS13550 (AB8O67_13555) tapA 2580448..2581209 (-) 762 WP_369888225.1 amyloid fiber anchoring/assembly protein TapA -
  AB8O67_RS13555 (AB8O67_13560) - 2581486..2581809 (+) 324 WP_024122040.1 YqzG/YhdC family protein -
  AB8O67_RS13560 (AB8O67_13565) - 2581852..2582031 (-) 180 WP_003236949.1 YqzE family protein -
  AB8O67_RS13565 (AB8O67_13570) comGG 2582103..2582478 (-) 376 Protein_2625 competence type IV pilus minor pilin ComGG -
  AB8O67_RS13570 (AB8O67_13575) comGF 2582479..2582862 (-) 384 WP_157722684.1 competence type IV pilus minor pilin ComGF Machinery gene
  AB8O67_RS13575 (AB8O67_13580) comGE 2582888..2583235 (-) 348 WP_369888226.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6675.62 Da        Isoelectric Point: 6.7231

>NTDB_id=1033200 AB8O67_RS13530 WP_024122036.1 2578413..2578586(+) (sinI) [Bacillus halotolerans strain XYK2-4]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=1033200 AB8O67_RS13530 WP_024122036.1 2578413..2578586(+) (sinI) [Bacillus halotolerans strain XYK2-4]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterProScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947

Multiple sequence alignment