Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AB2M34_RS19590 Genome accession   NZ_CP161903
Coordinates   3636663..3636785 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DYJ24     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3631663..3641785
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB2M34_RS19560 (AB2M34_19560) yclP 3631730..3632488 (-) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -
  AB2M34_RS19565 (AB2M34_19565) yclO 3632482..3633429 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  AB2M34_RS19570 (AB2M34_19570) ceuB 3633422..3634372 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  AB2M34_RS19575 (AB2M34_19575) thrD 3634763..3636127 (+) 1365 WP_021481755.1 aspartate kinase -
  AB2M34_RS19580 (AB2M34_19580) yczN 3636280..3636393 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  AB2M34_RS19585 (AB2M34_19585) yczM 3636475..3636564 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AB2M34_RS19590 (AB2M34_19590) phrC 3636663..3636785 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AB2M34_RS19595 (AB2M34_19595) rapC 3636769..3637917 (-) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  AB2M34_RS19600 (AB2M34_19600) yclK 3638081..3639502 (-) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  AB2M34_RS19605 (AB2M34_19605) yclJ 3639489..3640172 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1023101 AB2M34_RS19590 WP_003224994.1 3636663..3636785(-) (phrC) [Bacillus subtilis strain DYJ24]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1023101 AB2M34_RS19590 WP_003224994.1 3636663..3636785(-) (phrC) [Bacillus subtilis strain DYJ24]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment