Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   M036_RS02065 Genome accession   NZ_CP005997
Coordinates   413519..413641 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis TO-A     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 408519..418641
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  M036_RS02050 (M036_02025) yclJ 410133..410816 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  M036_RS02055 (M036_02030) yclK 410803..412224 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  M036_RS02060 (M036_02035) rapC 412387..413535 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  M036_RS02065 (M036_02040) phrC 413519..413641 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  M036_RS21120 (M036_02045) yczM 413741..413830 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  M036_RS02070 (M036_02050) yczN 413912..414025 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  M036_RS02075 (M036_02055) thrD 414179..415543 (-) 1365 WP_003234493.1 aspartate kinase -
  M036_RS02080 (M036_02060) ceuB 415928..416878 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  M036_RS02085 (M036_02065) yclO 416871..417818 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  M036_RS02090 (M036_02070) yclP 417812..418570 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=99887 M036_RS02065 WP_003224994.1 413519..413641(+) (phrC) [Bacillus subtilis TO-A]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=99887 M036_RS02065 WP_003224994.1 413519..413641(+) (phrC) [Bacillus subtilis TO-A]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1