Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   AAVB74_RS22075 Genome accession   NZ_CP154920
Coordinates   4153558..4153680 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain FUA2232     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 4148558..4158680
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAVB74_RS22045 (AAVB74_22045) yclP 4148630..4149388 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  AAVB74_RS22050 (AAVB74_22050) yclO 4149382..4150329 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AAVB74_RS22055 (AAVB74_22055) ceuB 4150322..4151272 (-) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  AAVB74_RS22060 (AAVB74_22060) thrD 4151657..4153021 (+) 1365 WP_224912752.1 aspartate kinase -
  AAVB74_RS22065 (AAVB74_22065) yczN 4153174..4153287 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  AAVB74_RS22070 (AAVB74_22070) yczM 4153369..4153458 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  AAVB74_RS22075 (AAVB74_22075) phrC 4153558..4153680 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AAVB74_RS22080 (AAVB74_22080) rapC 4153664..4154812 (-) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  AAVB74_RS22085 (AAVB74_22085) yclK 4154975..4156396 (-) 1422 WP_220396634.1 two-component system sensor histidine kinase YclK -
  AAVB74_RS22090 (AAVB74_22090) yclJ 4156383..4157066 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=995493 AAVB74_RS22075 WP_003224994.1 4153558..4153680(-) (phrC) [Bacillus subtilis strain FUA2232]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=995493 AAVB74_RS22075 WP_003224994.1 4153558..4153680(-) (phrC) [Bacillus subtilis strain FUA2232]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment