Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   AAC934_RS02210 Genome accession   NZ_CP152362
Coordinates   429761..429883 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain LP     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424761..434883
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AAC934_RS02195 (AAC934_02195) yclJ 426374..427057 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  AAC934_RS02200 (AAC934_02200) yclK 427044..428465 (+) 1422 WP_082098066.1 two-component system sensor histidine kinase YclK -
  AAC934_RS02205 (AAC934_02205) rapC 428629..429777 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  AAC934_RS02210 (AAC934_02210) phrC 429761..429883 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AAC934_RS02215 (AAC934_02215) yczM 429983..430072 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  AAC934_RS02220 (AAC934_02220) yczN 430154..430267 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  AAC934_RS02225 (AAC934_02225) thrD 430421..431785 (-) 1365 WP_038428355.1 aspartate kinase -
  AAC934_RS02230 (AAC934_02230) ceuB 432170..433120 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  AAC934_RS02235 (AAC934_02235) yclO 433113..434060 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AAC934_RS02240 (AAC934_02240) yclP 434054..434812 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=988584 AAC934_RS02210 WP_003224994.1 429761..429883(+) (phrC) [Bacillus subtilis strain LP]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=988584 AAC934_RS02210 WP_003224994.1 429761..429883(+) (phrC) [Bacillus subtilis strain LP]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment