Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NYE22_RS20105 Genome accession   NZ_CP151946
Coordinates   3769579..3769701 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL K6-1560     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3764579..3774701
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NYE22_RS20075 (NYE22_20075) yclP 3764651..3765409 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  NYE22_RS20080 (NYE22_20080) yclO 3765403..3766350 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NYE22_RS20085 (NYE22_20085) ceuB 3766343..3767293 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NYE22_RS20090 (NYE22_20090) - 3767678..3769042 (+) 1365 WP_032726529.1 aspartate kinase -
  NYE22_RS20095 (NYE22_20095) - 3769195..3769308 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  NYE22_RS20100 (NYE22_20100) - 3769390..3769479 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  NYE22_RS20105 (NYE22_20105) phrC 3769579..3769701 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NYE22_RS20110 (NYE22_20110) rapC 3769685..3770833 (-) 1149 WP_342412087.1 response regulator aspartate phosphatase RapC Regulator
  NYE22_RS20115 (NYE22_20115) yclK 3770996..3772417 (-) 1422 WP_080121165.1 two-component system sensor histidine kinase YclK -
  NYE22_RS20120 (NYE22_20120) yclJ 3772404..3773087 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=981749 NYE22_RS20105 WP_003224994.1 3769579..3769701(-) (phrC) [Bacillus sp. FSL K6-1560]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=981749 NYE22_RS20105 WP_003224994.1 3769579..3769701(-) (phrC) [Bacillus sp. FSL K6-1560]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment