Detailed information NTG0097907

Bioinformatically predicted

Overview

• Name: comGE/cglE
• Type: Machinery gene
• Locus tag: R8613_RS10220
• Genome accession: NZ_AP026919
• Coordinates: 1945536..1945838 (-)
• Length: 100 a.a.
• NCBI ID: WP_000413382.1
• Uniprot ID: -
• Organism: Streptococcus pneumoniae strain PZ900700012
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1940536..1950838

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
R8613_RS10185 (PC0012_19650)	rnpA	1941223..1941594 (-)	372	WP_000739246.1	ribonuclease P protein component	-
R8613_RS10190	-	1941611..1941742 (-)	132	WP_000768904.1	hypothetical protein	-
R8613_RS10195 (PC0012_19660)	-	1941743..1942933 (-)	1191	WP_000167769.1	acetate kinase	-
R8613_RS10200 (PC0012_19670)	comYH	1942984..1943937 (-)	954	WP_050072683.1	class I SAM-dependent methyltransferase	Machinery gene
R8613_RS10205 (PC0012_19680)	-	1943998..1944585 (-)	588	WP_000679772.1	class I SAM-dependent methyltransferase	-
R8613_RS10210 (PC0012_19690)	comGG/cglG	1944688..1945134 (-)	447	WP_001811371.1	competence type IV pilus minor pilin ComGG	Machinery gene
R8613_RS10215	comGF/cglF	1945112..1945573 (-)	462	WP_000250539.1	competence type IV pilus minor pilin ComGF	Machinery gene
R8613_RS10220 (PC0012_19710)	comGE/cglE	1945536..1945838 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
R8613_RS10225 (PC0012_19720)	comGD/cglD	1945801..1946205 (-)	405	WP_000588030.1	competence type IV pilus minor pilin ComGD	Machinery gene
R8613_RS10230 (PC0012_19730)	comGC/cglC	1946198..1946524 (-)	327	WP_219565693.1	competence type IV pilus major pilin ComGC	Machinery gene
R8613_RS10235 (PC0012_19740)	comGB/cglB	1946526..1947542 (-)	1017	WP_078132972.1	competence type IV pilus assembly protein ComGB	Machinery gene
R8613_RS10240 (PC0012_19750)	comGA/cglA/cilD	1947490..1948431 (-)	942	WP_001864563.1	competence type IV pilus ATPase ComGA	Machinery gene
R8613_RS10245 (PC0012_19760)	-	1948507..1948872 (-)	366	WP_000286415.1	DUF1033 family protein	-
R8613_RS10250 (PC0012_19770)	-	1949023..1950081 (-)	1059	WP_044812807.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

• Length: 100 a.a.
• Molecular weight: 11108.08 Da
• Isoelectric Point: 9.7273

>NTDB_id=97907 R8613_RS10220 WP_000413382.1 1945536..1945838(-) (comGE/cglE) [Streptococcus pneumoniae strain PZ900700012]
MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS
SEKGLEVYHGSEQLLAIKEP

Nucleotide

• Length: 303 bp

>NTDB_id=97907 R8613_RS10220 WP_000413382.1 1945536..1945838(-) (comGE/cglE) [Streptococcus pneumoniae strain PZ900700012]
ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT
TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG
TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT
AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (16-97)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4