Detailed information    

insolico Bioinformatically predicted

Overview

Name   HI0659   Type   Machinery gene
Locus tag   R8474_RS07430 Genome accession   NZ_AP026914
Coordinates   1470441..1470707 (-) Length   88 a.a.
NCBI ID   WP_001820593.1    Uniprot ID   A0A6I3UU84
Organism   Streptococcus pneumoniae strain PZ900700003     
Function   DNA uptake (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
Genomic island 1471392..1487307 1470441..1470707 flank 685
IScluster/Tn 1470785..1471236 1470441..1470707 flank 78


Gene organization within MGE regions


Location: 1470441..1487307
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R8474_RS07430 (PC0003_14710) HI0659 1470441..1470707 (-) 267 WP_001820593.1 helix-turn-helix domain-containing protein Machinery gene
  R8474_RS07435 - 1470791..1471236 (-) 446 Protein_1470 helix-turn-helix domain-containing protein -
  R8474_RS07440 (PC0003_14740) - 1471392..1472393 (+) 1002 WP_000597985.1 endonuclease/exonuclease/phosphatase family protein -
  R8474_RS07445 (PC0003_14750) pheT 1472461..1474866 (-) 2406 WP_317641640.1 phenylalanine--tRNA ligase subunit beta -
  R8474_RS07450 (PC0003_14760) - 1474943..1475452 (-) 510 WP_000619941.1 N-acetyltransferase -
  R8474_RS07455 (PC0003_14770) pheS 1475452..1476498 (-) 1047 WP_001854223.1 phenylalanine--tRNA ligase subunit alpha -
  R8474_RS07460 (PC0003_14780) - 1477090..1478505 (-) 1416 WP_050199962.1 glycoside hydrolase family 1 protein -
  R8474_RS07465 (PC0003_14790) - 1478518..1480356 (-) 1839 WP_000120570.1 beta-glucoside-specific PTS transporter subunit IIABC -
  R8474_RS07470 (PC0003_14800) licT 1480374..1481213 (-) 840 WP_000584530.1 BglG family transcription antiterminator LicT -
  R8474_RS07475 (PC0003_14810) - 1481755..1483104 (+) 1350 Protein_1478 IS3 family transposase -
  R8474_RS07480 (PC0003_14830) - 1483220..1484023 (-) 804 WP_001183265.1 Fic/DOC family protein -
  R8474_RS07485 - 1484241..1484382 (-) 142 Protein_1480 DNA (cytosine-5-)-methyltransferase -
  R8474_RS07490 (PC0003_14840) - 1484403..1486235 (-) 1833 WP_000369972.1 ATP-binding protein -
  R8474_RS07495 (PC0003_14850) - 1486216..1487307 (-) 1092 WP_000516550.1 DNA cytosine methyltransferase -

Sequence

Protein


Download         Length: 88 a.a.        Molecular weight: 9670.12 Da        Isoelectric Point: 4.3934

>NTDB_id=97494 R8474_RS07430 WP_001820593.1 1470441..1470707(-) (HI0659) [Streptococcus pneumoniae strain PZ900700003]
MEGCPSELFSKEEILESDMRVAIMSELIEARHEQGINQRKLEELSGVSQPVIARMETGESSLQLDTVLKVLTSLGKTLAV
VPLEQGKS

Nucleotide


Download         Length: 267 bp        

>NTDB_id=97494 R8474_RS07430 WP_001820593.1 1470441..1470707(-) (HI0659) [Streptococcus pneumoniae strain PZ900700003]
TTGGAAGGATGTCCATCTGAGCTCTTTAGCAAGGAGGAAATCCTTGAAAGTGATATGCGAGTGGCTATTATGAGCGAGTT
GATTGAAGCTAGACATGAACAAGGAATCAATCAGAGAAAGCTAGAAGAACTCAGTGGAGTGAGTCAACCTGTCATAGCTA
GGATGGAAACAGGAGAGAGCAGTCTTCAGTTGGATACGGTCTTAAAAGTTCTAACCAGTCTAGGAAAGACACTAGCAGTC
GTTCCACTTGAACAGGGGAAAAGTTGA

Domains

Predicted by InterproScan.

Helix-turn-helix (HTH_3)

(28-79)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A6I3UU84

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  HI0659 Haemophilus influenzae Rd KW20

55.844

87.5

0.489

Multiple sequence alignment