Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   MHB62_RS02170 Genome accession   NZ_CP150278
Coordinates   429493..429615 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL K6-0255     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424493..434615
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MHB62_RS02155 (MHB62_02155) yclJ 426107..426790 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  MHB62_RS02160 (MHB62_02160) yclK 426777..428198 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  MHB62_RS02165 (MHB62_02165) rapC 428361..429509 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  MHB62_RS02170 (MHB62_02170) phrC 429493..429615 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MHB62_RS02175 (MHB62_02175) - 429715..429804 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MHB62_RS02180 (MHB62_02180) - 429886..429999 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  MHB62_RS02185 (MHB62_02185) - 430152..431516 (-) 1365 WP_015715246.1 aspartate kinase -
  MHB62_RS02190 (MHB62_02190) ceuB 431901..432851 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MHB62_RS02195 (MHB62_02195) yclO 432844..433791 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  MHB62_RS02200 (MHB62_02200) yclP 433785..434543 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=969232 MHB62_RS02170 WP_003224994.1 429493..429615(+) (phrC) [Bacillus sp. FSL K6-0255]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=969232 MHB62_RS02170 WP_003224994.1 429493..429615(+) (phrC) [Bacillus sp. FSL K6-0255]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment