Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MKY56_RS02185 Genome accession   NZ_CP150257
Coordinates   428649..428771 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL M8-0054     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423649..433771
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MKY56_RS02170 (MKY56_02170) yclJ 425262..425945 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MKY56_RS02175 (MKY56_02175) yclK 425932..427353 (+) 1422 WP_080479511.1 two-component system sensor histidine kinase YclK -
  MKY56_RS02180 (MKY56_02180) rapC 427517..428665 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  MKY56_RS02185 (MKY56_02185) phrC 428649..428771 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MKY56_RS02190 (MKY56_02190) - 428871..428960 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MKY56_RS02195 (MKY56_02195) - 429042..429155 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MKY56_RS02200 (MKY56_02200) - 429309..430673 (-) 1365 WP_033883679.1 aspartate kinase -
  MKY56_RS02205 (MKY56_02205) ceuB 431058..432008 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MKY56_RS02210 (MKY56_02210) yclO 432001..432948 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  MKY56_RS02215 (MKY56_02215) yclP 432942..433700 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=968199 MKY56_RS02185 WP_003224994.1 428649..428771(+) (phrC) [Bacillus sp. FSL M8-0054]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=968199 MKY56_RS02185 WP_003224994.1 428649..428771(+) (phrC) [Bacillus sp. FSL M8-0054]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment