Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MKX71_RS02135 Genome accession   NZ_CP150256
Coordinates   425543..425665 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL M8-0071     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 420543..430665
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MKX71_RS02120 (MKX71_02120) yclJ 422157..422840 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MKX71_RS02125 (MKX71_02125) yclK 422827..424248 (+) 1422 WP_327842792.1 two-component system sensor histidine kinase YclK -
  MKX71_RS02130 (MKX71_02130) rapC 424411..425559 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  MKX71_RS02135 (MKX71_02135) phrC 425543..425665 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MKX71_RS02140 (MKX71_02140) - 425765..425854 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MKX71_RS02145 (MKX71_02145) - 425936..426049 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MKX71_RS02150 (MKX71_02150) - 426203..427567 (-) 1365 WP_212059765.1 aspartate kinase -
  MKX71_RS02155 (MKX71_02155) ceuB 427952..428902 (+) 951 WP_087960839.1 petrobactin ABC transporter permease YclN Machinery gene
  MKX71_RS02160 (MKX71_02160) yclO 428895..429842 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  MKX71_RS02165 (MKX71_02165) yclP 429836..430594 (+) 759 WP_212059767.1 ABC transporter ATP-binding protein -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=968120 MKX71_RS02135 WP_003224994.1 425543..425665(+) (phrC) [Bacillus sp. FSL M8-0071]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=968120 MKX71_RS02135 WP_003224994.1 425543..425665(+) (phrC) [Bacillus sp. FSL M8-0071]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment