Detailed information
Bioinformatically predicted
Overview
| Name | rok | Type | Regulator |
| Locus tag | MKY61_RS10555 | Genome accession | NZ_CP150247 |
| Coordinates | 2042895..2043371 (+) | Length | 158 a.a. |
| NCBI ID | WP_003182174.1 | Uniprot ID | A0A1Y0YPP5 |
| Organism | Bacillus sp. FSL M8-0315 | ||
| Function | repression of comK (predicted from homology) Competence regulation |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 1990876..2045927 | 2042895..2043371 | within | 0 |
Gene organization within MGE regions
Location: 1990876..2045927
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MKY61_RS10250 (MKY61_10250) | - | 1990876..1992021 (-) | 1146 | WP_071583919.1 | site-specific integrase | - |
| MKY61_RS10255 (MKY61_10255) | - | 1992028..1992393 (-) | 366 | WP_071583954.1 | ImmA/IrrE family metallo-endopeptidase | - |
| MKY61_RS10260 (MKY61_10260) | - | 1992402..1992830 (-) | 429 | WP_026587142.1 | helix-turn-helix transcriptional regulator | - |
| MKY61_RS10265 (MKY61_10265) | - | 1993099..1993284 (+) | 186 | WP_026587143.1 | helix-turn-helix transcriptional regulator | - |
| MKY61_RS10270 (MKY61_10270) | - | 1993290..1993559 (+) | 270 | WP_061578517.1 | group-specific protein | - |
| MKY61_RS10275 (MKY61_10275) | - | 1993683..1993949 (+) | 267 | WP_009330095.1 | YqaH family protein | - |
| MKY61_RS10280 (MKY61_10280) | - | 1994037..1994279 (+) | 243 | WP_011198322.1 | hypothetical protein | - |
| MKY61_RS10285 (MKY61_10285) | - | 1994373..1994819 (+) | 447 | WP_069500487.1 | hypothetical protein | - |
| MKY61_RS10290 (MKY61_10290) | - | 1994816..1995991 (+) | 1176 | WP_196770007.1 | DUF2800 domain-containing protein | - |
| MKY61_RS10295 (MKY61_10295) | - | 1996023..1996562 (+) | 540 | WP_071583882.1 | DUF2815 family protein | - |
| MKY61_RS10300 (MKY61_10300) | - | 1996651..1996896 (+) | 246 | WP_069500491.1 | hypothetical protein | - |
| MKY61_RS10305 (MKY61_10305) | - | 1996902..1998845 (+) | 1944 | WP_069500492.1 | DNA polymerase | - |
| MKY61_RS10310 (MKY61_10310) | - | 1998961..2001372 (+) | 2412 | WP_081329458.1 | VapE domain-containing protein | - |
| MKY61_RS10315 (MKY61_10315) | - | 2001661..2001945 (+) | 285 | WP_069500915.1 | VRR-NUC domain-containing protein | - |
| MKY61_RS10320 (MKY61_10320) | - | 2001935..2003290 (+) | 1356 | WP_069500496.1 | DEAD/DEAH box helicase | - |
| MKY61_RS10325 (MKY61_10325) | - | 2003287..2003667 (+) | 381 | WP_071584222.1 | ArpU family phage packaging/lysis transcriptional regulator | - |
| MKY61_RS10330 (MKY61_10330) | cotD | 2004408..2004632 (+) | 225 | WP_003185368.1 | spore coat protein CotD | - |
| MKY61_RS10335 (MKY61_10335) | - | 2004886..2005560 (+) | 675 | WP_071583909.1 | hypothetical protein | - |
| MKY61_RS10340 (MKY61_10340) | - | 2005636..2005944 (+) | 309 | WP_081364462.1 | hypothetical protein | - |
| MKY61_RS10345 (MKY61_10345) | - | 2005971..2006345 (+) | 375 | WP_071583908.1 | HNH endonuclease | - |
| MKY61_RS10350 (MKY61_10350) | - | 2006576..2007091 (+) | 516 | WP_071583907.1 | phage terminase small subunit P27 family | - |
| MKY61_RS10355 (MKY61_10355) | - | 2007088..2008797 (+) | 1710 | WP_071583906.1 | terminase TerL endonuclease subunit | - |
| MKY61_RS10360 (MKY61_10360) | - | 2008810..2009001 (+) | 192 | WP_035316082.1 | DUF1056 family protein | - |
| MKY61_RS10365 (MKY61_10365) | - | 2009002..2010312 (+) | 1311 | WP_071583905.1 | phage portal protein | - |
| MKY61_RS10370 (MKY61_10370) | - | 2010257..2010988 (+) | 732 | WP_071583904.1 | head maturation protease, ClpP-related | - |
| MKY61_RS10375 (MKY61_10375) | - | 2011059..2012339 (+) | 1281 | WP_075646713.1 | phage major capsid protein | - |
| MKY61_RS10380 (MKY61_10380) | - | 2012362..2012787 (+) | 426 | WP_065643430.1 | collagen-like protein | - |
| MKY61_RS10385 (MKY61_10385) | - | 2012808..2013110 (+) | 303 | WP_003185351.1 | head-tail connector protein | - |
| MKY61_RS10390 (MKY61_10390) | - | 2013100..2013408 (+) | 309 | WP_065643429.1 | phage head closure protein | - |
| MKY61_RS10395 (MKY61_10395) | - | 2013408..2013805 (+) | 398 | Protein_2003 | HK97-gp10 family putative phage morphogenesis protein | - |
| MKY61_RS10400 (MKY61_10400) | - | 2013802..2014185 (+) | 384 | WP_043054227.1 | DUF3168 domain-containing protein | - |
| MKY61_RS10405 (MKY61_10405) | - | 2014200..2014817 (+) | 618 | WP_043054228.1 | major tail protein | - |
| MKY61_RS10410 (MKY61_10410) | - | 2014871..2015236 (+) | 366 | WP_071583608.1 | hypothetical protein | - |
| MKY61_RS10415 (MKY61_10415) | - | 2015445..2019914 (+) | 4470 | WP_095324191.1 | phage tail tape measure protein | - |
| MKY61_RS10420 (MKY61_10420) | - | 2019914..2020750 (+) | 837 | WP_069500502.1 | phage tail family protein | - |
| MKY61_RS10425 (MKY61_10425) | - | 2020763..2022475 (+) | 1713 | WP_071584250.1 | phage tail protein | - |
| MKY61_RS10430 (MKY61_10430) | - | 2022512..2025157 (+) | 2646 | WP_071583773.1 | peptidase G2 autoproteolytic cleavage domain-containing protein | - |
| MKY61_RS10435 (MKY61_10435) | - | 2025171..2026520 (+) | 1350 | WP_081364464.1 | phage baseplate upper protein | - |
| MKY61_RS10440 (MKY61_10440) | - | 2026533..2026856 (+) | 324 | WP_069500506.1 | hypothetical protein | - |
| MKY61_RS10445 (MKY61_10445) | - | 2026853..2027035 (+) | 183 | WP_039072971.1 | XkdX family protein | - |
| MKY61_RS10450 (MKY61_10450) | - | 2027099..2027368 (+) | 270 | WP_069500916.1 | hemolysin XhlA family protein | - |
| MKY61_RS10455 (MKY61_10455) | - | 2027384..2027647 (+) | 264 | WP_069500507.1 | phage holin | - |
| MKY61_RS10460 (MKY61_10460) | - | 2027695..2028648 (+) | 954 | WP_069500508.1 | glycoside hydrolase family 25 protein | - |
| MKY61_RS10465 (MKY61_10465) | - | 2028771..2029109 (-) | 339 | WP_069500509.1 | hypothetical protein | - |
| MKY61_RS10470 (MKY61_10470) | - | 2029125..2030654 (-) | 1530 | WP_269195050.1 | T7SS effector LXG polymorphic toxin | - |
| MKY61_RS10475 (MKY61_10475) | - | 2030850..2030993 (+) | 144 | WP_021837703.1 | hypothetical protein | - |
| MKY61_RS10480 (MKY61_10480) | - | 2031248..2031478 (+) | 231 | WP_011198296.1 | helix-turn-helix domain-containing protein | - |
| MKY61_RS10485 (MKY61_10485) | - | 2031502..2031869 (-) | 368 | Protein_2021 | YolD-like family protein | - |
| MKY61_RS10490 (MKY61_10490) | - | 2031959..2032771 (-) | 813 | WP_035338318.1 | hypothetical protein | - |
| MKY61_RS10495 (MKY61_10495) | - | 2033373..2033576 (+) | 204 | WP_003182148.1 | hypothetical protein | - |
| MKY61_RS10500 (MKY61_10500) | - | 2034678..2035145 (+) | 468 | WP_003182152.1 | DUF6323 family protein | - |
| MKY61_RS10505 (MKY61_10505) | - | 2035147..2036583 (+) | 1437 | WP_003182154.1 | DUF6179 domain-containing protein | - |
| MKY61_RS10510 (MKY61_10510) | - | 2036710..2037027 (-) | 318 | WP_003182156.1 | hypothetical protein | - |
| MKY61_RS10515 (MKY61_10515) | - | 2037380..2037808 (+) | 429 | WP_003182158.1 | HIT domain-containing protein | - |
| MKY61_RS10520 (MKY61_10520) | - | 2038452..2038754 (+) | 303 | WP_003182160.1 | hypothetical protein | - |
| MKY61_RS10525 (MKY61_10525) | - | 2038987..2039964 (+) | 978 | WP_071583709.1 | alpha/beta hydrolase family protein | - |
| MKY61_RS10530 (MKY61_10530) | - | 2040027..2040269 (+) | 243 | WP_003182164.1 | hypothetical protein | - |
| MKY61_RS10535 (MKY61_10535) | - | 2040322..2040801 (+) | 480 | WP_003182166.1 | hypothetical protein | - |
| MKY61_RS10540 (MKY61_10540) | - | 2040943..2041539 (+) | 597 | WP_003182167.1 | class I SAM-dependent methyltransferase | - |
| MKY61_RS10545 (MKY61_10545) | - | 2041646..2042125 (+) | 480 | WP_003182169.1 | YdhH/YoaO family protein | - |
| MKY61_RS10550 (MKY61_10550) | - | 2042159..2042734 (+) | 576 | WP_071583710.1 | GNAT family N-acetyltransferase | - |
| MKY61_RS10555 (MKY61_10555) | rok | 2042895..2043371 (+) | 477 | WP_003182174.1 | hypothetical protein | Regulator |
| MKY61_RS10560 (MKY61_10560) | - | 2043490..2043663 (+) | 174 | WP_003182176.1 | hypothetical protein | - |
| MKY61_RS10565 (MKY61_10565) | - | 2044012..2044632 (-) | 621 | WP_003182178.1 | hypothetical protein | - |
| MKY61_RS10570 (MKY61_10570) | - | 2045343..2045927 (+) | 585 | WP_009328246.1 | TetR family transcriptional regulator | - |
Sequence
Protein
Download Length: 158 a.a. Molecular weight: 18302.15 Da Isoelectric Point: 10.1366
>NTDB_id=967579 MKY61_RS10555 WP_003182174.1 2042895..2043371(+) (rok) [Bacillus sp. FSL M8-0315]
MFNEREALRLRLEQLGDAEIQVMRELRKEREGIYSKLRELDRESEPAINKKSSLIDLASAAAEELKQSQHAADKHPPIKT
PSHTIFQSKTTIQREAAINILSRYEEGLKGIKLKTEIEKETGFPIKNMTTFMKSLMKHRPDIKKPARGHYILHKEKDL
MFNEREALRLRLEQLGDAEIQVMRELRKEREGIYSKLRELDRESEPAINKKSSLIDLASAAAEELKQSQHAADKHPPIKT
PSHTIFQSKTTIQREAAINILSRYEEGLKGIKLKTEIEKETGFPIKNMTTFMKSLMKHRPDIKKPARGHYILHKEKDL
Nucleotide
Download Length: 477 bp
>NTDB_id=967579 MKY61_RS10555 WP_003182174.1 2042895..2043371(+) (rok) [Bacillus sp. FSL M8-0315]
ATGTTCAACGAAAGAGAAGCGTTGCGTTTGAGACTTGAACAGCTAGGTGATGCGGAGATCCAGGTGATGCGGGAATTGCG
AAAAGAACGAGAGGGCATTTATTCGAAGCTGCGTGAATTGGATCGGGAGAGTGAGCCTGCAATTAACAAAAAATCTTCAT
TAATCGACTTGGCAAGCGCTGCAGCAGAGGAATTAAAACAATCCCAGCATGCCGCTGACAAACATCCGCCTATCAAGACC
CCATCTCATACTATTTTCCAATCAAAAACAACCATACAGCGTGAGGCTGCCATAAACATTTTAAGCCGCTATGAAGAGGG
CTTGAAAGGCATTAAGCTCAAAACTGAAATCGAGAAAGAAACCGGCTTTCCGATTAAAAACATGACGACATTTATGAAGA
GCTTAATGAAACATCGCCCAGATATTAAAAAGCCTGCCCGCGGCCATTATATTTTGCATAAAGAAAAAGACCTTTGA
ATGTTCAACGAAAGAGAAGCGTTGCGTTTGAGACTTGAACAGCTAGGTGATGCGGAGATCCAGGTGATGCGGGAATTGCG
AAAAGAACGAGAGGGCATTTATTCGAAGCTGCGTGAATTGGATCGGGAGAGTGAGCCTGCAATTAACAAAAAATCTTCAT
TAATCGACTTGGCAAGCGCTGCAGCAGAGGAATTAAAACAATCCCAGCATGCCGCTGACAAACATCCGCCTATCAAGACC
CCATCTCATACTATTTTCCAATCAAAAACAACCATACAGCGTGAGGCTGCCATAAACATTTTAAGCCGCTATGAAGAGGG
CTTGAAAGGCATTAAGCTCAAAACTGAAATCGAGAAAGAAACCGGCTTTCCGATTAAAAACATGACGACATTTATGAAGA
GCTTAATGAAACATCGCCCAGATATTAAAAAGCCTGCCCGCGGCCATTATATTTTGCATAAAGAAAAAGACCTTTGA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| rok | Bacillus subtilis subsp. subtilis str. 168 |
45.055 |
100 |
0.519 |