Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSU05_RS02145 Genome accession   NZ_CP150177
Coordinates   422378..422500 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. EU52     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 417378..427500
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSU05_RS02130 (NSU05_02130) yclJ 418991..419674 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NSU05_RS02135 (NSU05_02135) yclK 419661..421082 (+) 1422 WP_339204406.1 two-component system sensor histidine kinase YclK -
  NSU05_RS02140 (NSU05_02140) rapC 421246..422394 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  NSU05_RS02145 (NSU05_02145) phrC 422378..422500 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSU05_RS02150 (NSU05_02150) - 422600..422689 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSU05_RS02155 (NSU05_02155) - 422771..422884 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NSU05_RS02160 (NSU05_02160) - 423038..424402 (-) 1365 WP_033883679.1 aspartate kinase -
  NSU05_RS02165 (NSU05_02165) ceuB 424787..425737 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NSU05_RS02170 (NSU05_02170) yclO 425730..426677 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NSU05_RS02175 (NSU05_02175) yclP 426671..427429 (+) 759 WP_041336852.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=965054 NSU05_RS02145 WP_003224994.1 422378..422500(+) (phrC) [Bacillus sp. EU52]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=965054 NSU05_RS02145 WP_003224994.1 422378..422500(+) (phrC) [Bacillus sp. EU52]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment