Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSS90_RS02255 Genome accession   NZ_CP150161
Coordinates   434442..434564 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. PS93     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 429442..439564
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSS90_RS02240 (NSS90_02240) yclJ 431055..431738 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NSS90_RS02245 (NSS90_02245) yclK 431725..433146 (+) 1422 WP_339175803.1 two-component system sensor histidine kinase YclK -
  NSS90_RS02250 (NSS90_02250) rapC 433310..434458 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  NSS90_RS02255 (NSS90_02255) phrC 434442..434564 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSS90_RS02260 (NSS90_02260) - 434664..434753 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSS90_RS02265 (NSS90_02265) - 434835..434948 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NSS90_RS02270 (NSS90_02270) - 435102..436466 (-) 1365 WP_003234493.1 aspartate kinase -
  NSS90_RS02275 (NSS90_02275) ceuB 436851..437801 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NSS90_RS02280 (NSS90_02280) yclO 437794..438741 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NSS90_RS02285 (NSS90_02285) yclP 438735..439493 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=964118 NSS90_RS02255 WP_003224994.1 434442..434564(+) (phrC) [Bacillus sp. PS93]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=964118 NSS90_RS02255 WP_003224994.1 434442..434564(+) (phrC) [Bacillus sp. PS93]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment