Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NSQ21_RS02165 Genome accession   NZ_CP150158
Coordinates   429546..429668 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. PS210     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424546..434668
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSQ21_RS02150 (NSQ21_02150) yclJ 426160..426843 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NSQ21_RS02155 (NSQ21_02155) yclK 426830..428251 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  NSQ21_RS02160 (NSQ21_02160) rapC 428414..429562 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NSQ21_RS02165 (NSQ21_02165) phrC 429546..429668 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSQ21_RS02170 (NSQ21_02170) - 429768..429857 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSQ21_RS02175 (NSQ21_02175) - 429939..430052 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NSQ21_RS02180 (NSQ21_02180) - 430206..431570 (-) 1365 WP_003234493.1 aspartate kinase -
  NSQ21_RS02185 (NSQ21_02185) ceuB 431955..432905 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  NSQ21_RS02190 (NSQ21_02190) yclO 432898..433845 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NSQ21_RS02195 (NSQ21_02195) yclP 433839..434597 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=963875 NSQ21_RS02165 WP_003224994.1 429546..429668(+) (phrC) [Bacillus sp. PS210]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=963875 NSQ21_RS02165 WP_003224994.1 429546..429668(+) (phrC) [Bacillus sp. PS210]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1