Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NSQ83_RS02500 Genome accession   NZ_CP150157
Coordinates   474302..474424 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. PS217     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 469302..479424
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NSQ83_RS02485 (NSQ83_02485) yclJ 470916..471599 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NSQ83_RS02490 (NSQ83_02490) yclK 471586..473007 (+) 1422 WP_134818942.1 two-component system sensor histidine kinase YclK -
  NSQ83_RS02495 (NSQ83_02495) rapC 473170..474318 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  NSQ83_RS02500 (NSQ83_02500) phrC 474302..474424 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NSQ83_RS02505 (NSQ83_02505) - 474524..474613 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NSQ83_RS02510 (NSQ83_02510) - 474695..474808 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  NSQ83_RS02515 (NSQ83_02515) - 474961..476325 (-) 1365 WP_015252822.1 aspartate kinase -
  NSQ83_RS02520 (NSQ83_02520) ceuB 476709..477659 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NSQ83_RS02525 (NSQ83_02525) yclO 477652..478599 (+) 948 WP_131227116.1 petrobactin ABC transporter permease YclO -
  NSQ83_RS02530 (NSQ83_02530) yclP 478593..479351 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=963797 NSQ83_RS02500 WP_003224994.1 474302..474424(+) (phrC) [Bacillus sp. PS217]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=963797 NSQ83_RS02500 WP_003224994.1 474302..474424(+) (phrC) [Bacillus sp. PS217]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1