Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   WHO49_RS02165 Genome accession   NZ_CP148110
Coordinates   429559..429681 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate FELIX_MS499     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424559..434681
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WHO49_RS02150 yclJ 426173..426856 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WHO49_RS02155 yclK 426843..428264 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  WHO49_RS02160 rapC 428427..429575 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WHO49_RS02165 phrC 429559..429681 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WHO49_RS02170 yczM 429781..429870 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WHO49_RS02175 yczN 429952..430065 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WHO49_RS02180 thrD 430219..431583 (-) 1365 WP_003234493.1 aspartate kinase -
  WHO49_RS02185 ceuB 431968..432918 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  WHO49_RS02190 yclO 432911..433858 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WHO49_RS02195 yclP 433852..434610 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=950719 WHO49_RS02165 WP_003224994.1 429559..429681(+) (phrC) [Bacillus subtilis isolate FELIX_MS499]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=950719 WHO49_RS02165 WP_003224994.1 429559..429681(+) (phrC) [Bacillus subtilis isolate FELIX_MS499]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1