Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   LLL8_RS11095 Genome accession   NZ_AP025700
Coordinates   2246139..2246435 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis strain L8     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Related MGE


Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
Prophage 2243135..2294803 2246139..2246435 within 0


Gene organization within MGE regions


Location: 2243135..2294803
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLL8_RS11070 (LLL8_21690) - 2243135..2243872 (-) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  LLL8_RS11075 (LLL8_21700) - 2244049..2244891 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  LLL8_RS11080 (LLL8_21710) - 2244888..2245325 (-) 438 WP_201248645.1 zinc-dependent MarR family transcriptional regulator -
  LLL8_RS11085 (LLL8_21720) comGG 2245407..2245691 (-) 285 WP_025017139.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLL8_RS11090 (LLL8_21730) comGF 2245730..2246176 (-) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLL8_RS11095 (LLL8_21740) comGE 2246139..2246435 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLL8_RS11100 (LLL8_21750) comGD 2246407..2246823 (-) 417 WP_032941843.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLL8_RS11105 (LLL8_21760) comGC 2246798..2247067 (-) 270 WP_021721869.1 competence type IV pilus major pilin ComGC Machinery gene
  LLL8_RS11110 (LLL8_21770) - 2247121..2248368 (-) 1248 WP_251899926.1 Fic family protein -
  LLL8_RS11120 (LLL8_21780) - 2249061..2249840 (-) 780 WP_350028262.1 peptidoglycan amidohydrolase family protein -
  LLL8_RS11125 (LLL8_21790) - 2249840..2250127 (-) 288 WP_251899928.1 phage holin -
  LLL8_RS11130 (LLL8_21800) - 2250140..2250367 (-) 228 WP_251899929.1 hemolysin XhlA family protein -
  LLL8_RS11135 (LLL8_21810) - 2250383..2251372 (-) 990 WP_251899930.1 hypothetical protein -
  LLL8_RS11140 (LLL8_21820) - 2251372..2251509 (-) 138 WP_162838863.1 hypothetical protein -
  LLL8_RS11145 (LLL8_21830) - 2251506..2254043 (-) 2538 WP_251899931.1 gp58-like family protein -
  LLL8_RS11150 (LLL8_21840) - 2254055..2254420 (-) 366 WP_251899932.1 DUF6711 family protein -
  LLL8_RS11155 (LLL8_21850) - 2254432..2259432 (-) 5001 WP_251899933.1 phage tail protein -
  LLL8_RS11160 (LLL8_21860) - 2259465..2259836 (-) 372 WP_058211308.1 hypothetical protein -
  LLL8_RS11165 (LLL8_21870) - 2259860..2260270 (-) 411 WP_021722204.1 DUF6096 family protein -
  LLL8_RS11170 (LLL8_21880) - 2260346..2260585 (-) 240 WP_058219331.1 Ig-like domain-containing protein -
  LLL8_RS11175 (LLL8_21890) - 2260611..2261024 (-) 414 WP_058203522.1 hypothetical protein -
  LLL8_RS11180 (LLL8_21900) - 2261037..2261399 (-) 363 WP_251899934.1 hypothetical protein -
  LLL8_RS11185 (LLL8_21910) - 2261399..2261947 (-) 549 WP_032946647.1 hypothetical protein -
  LLL8_RS11190 (LLL8_21920) - 2261931..2262284 (-) 354 WP_251899935.1 hypothetical protein -
  LLL8_RS11195 (LLL8_21930) - 2262271..2262597 (-) 327 WP_251899936.1 phage head-tail connector protein -
  LLL8_RS11200 (LLL8_21940) - 2262618..2263736 (-) 1119 WP_251899937.1 Ig-like domain-containing protein -
  LLL8_RS11205 (LLL8_21950) - 2263749..2264405 (-) 657 WP_251900450.1 DUF4355 domain-containing protein -
  LLL8_RS11210 (LLL8_21960) - 2264521..2264679 (-) 159 WP_153497199.1 hypothetical protein -
  LLL8_RS11215 (LLL8_21970) - 2264782..2265888 (-) 1107 WP_251899938.1 minor capsid protein -
  LLL8_RS11220 (LLL8_21980) - 2265898..2266275 (-) 378 WP_251899939.1 hypothetical protein -
  LLL8_RS11225 (LLL8_21990) - 2266277..2266564 (-) 288 WP_251899940.1 ribosomal-processing cysteine protease Prp -
  LLL8_RS11230 (LLL8_22000) - 2266561..2266725 (-) 165 WP_251899941.1 hypothetical protein -
  LLL8_RS11235 (LLL8_22010) - 2266682..2268190 (-) 1509 WP_251899942.1 phage portal protein -
  LLL8_RS11240 (LLL8_22020) - 2268200..2269483 (-) 1284 WP_251899943.1 PBSX family phage terminase large subunit -
  LLL8_RS11245 (LLL8_22030) - 2269476..2269922 (-) 447 WP_251899944.1 terminase small subunit -
  LLL8_RS11260 (LLL8_22040) - 2270907..2271332 (-) 426 WP_058203511.1 RinA family protein -
  LLL8_RS11265 (LLL8_22060) - 2271560..2271736 (-) 177 WP_251899945.1 hypothetical protein -
  LLL8_RS11270 (LLL8_22070) - 2271987..2272172 (-) 186 WP_238076579.1 hypothetical protein -
  LLL8_RS11275 (LLL8_22080) - 2272180..2272395 (-) 216 WP_251899946.1 hypothetical protein -
  LLL8_RS11280 (LLL8_22090) - 2272407..2272610 (-) 204 WP_251899947.1 hypothetical protein -
  LLL8_RS11285 (LLL8_22100) - 2272662..2273117 (-) 456 WP_251899948.1 hypothetical protein -
  LLL8_RS11290 (LLL8_22110) - 2273129..2273581 (-) 453 WP_251899949.1 hypothetical protein -
  LLL8_RS11295 (LLL8_22120) - 2273553..2273882 (-) 330 WP_251899950.1 hypothetical protein -
  LLL8_RS11300 (LLL8_22130) dut 2273885..2274307 (-) 423 WP_251899951.1 dUTP diphosphatase -
  LLL8_RS12280 (LLL8_22140) - 2274320..2274454 (-) 135 WP_255531077.1 hypothetical protein -
  LLL8_RS11305 (LLL8_22150) - 2274451..2274801 (-) 351 WP_251899952.1 hypothetical protein -
  LLL8_RS11310 (LLL8_22160) - 2274798..2275352 (-) 555 WP_251899953.1 DUF1642 domain-containing protein -
  LLL8_RS11315 (LLL8_22170) - 2275349..2275558 (-) 210 WP_251899954.1 hypothetical protein -
  LLL8_RS11320 (LLL8_22180) - 2275545..2275733 (-) 189 WP_251899955.1 hypothetical protein -
  LLL8_RS11325 (LLL8_22190) - 2275744..2276313 (-) 570 WP_251899956.1 DUF658 family protein -
  LLL8_RS11330 (LLL8_22200) - 2276294..2276485 (-) 192 WP_251899957.1 DUF1497 domain-containing protein -
  LLL8_RS11335 (LLL8_22210) - 2276594..2276833 (-) 240 WP_251899958.1 DUF1031 domain-containing protein -
  LLL8_RS11340 (LLL8_22220) - 2276834..2277253 (-) 420 WP_251899959.1 hypothetical protein -
  LLL8_RS11345 (LLL8_22230) - 2277243..2277464 (-) 222 WP_021211208.1 hypothetical protein -
  LLL8_RS11350 (LLL8_22240) - 2277445..2278248 (-) 804 WP_251899960.1 helix-turn-helix domain-containing protein -
  LLL8_RS11355 (LLL8_22250) - 2278248..2278574 (-) 327 WP_251899961.1 HNH endonuclease -
  LLL8_RS11360 (LLL8_22260) - 2278841..2279767 (-) 927 WP_251899962.1 RecT family recombinase -
  LLL8_RS11365 (LLL8_22270) - 2279764..2280597 (-) 834 WP_251899963.1 hypothetical protein -
  LLL8_RS11370 (LLL8_22280) - 2280720..2280935 (-) 216 WP_023189642.1 DUF1408 domain-containing protein -
  LLL8_RS11375 (LLL8_22290) - 2280935..2281135 (-) 201 WP_058211380.1 helix-turn-helix transcriptional regulator -
  LLL8_RS11380 (LLL8_22300) - 2281283..2281615 (+) 333 WP_180259877.1 hypothetical protein -
  LLL8_RS11385 (LLL8_22310) - 2281566..2281787 (-) 222 WP_251899964.1 hypothetical protein -
  LLL8_RS11390 (LLL8_22320) - 2281927..2282121 (-) 195 WP_251899965.1 hypothetical protein -
  LLL8_RS11395 (LLL8_22330) - 2282134..2282943 (-) 810 WP_251899966.1 phage antirepressor KilAC domain-containing protein -
  LLL8_RS11400 (LLL8_22340) - 2282955..2283203 (-) 249 WP_251899967.1 helix-turn-helix transcriptional regulator -
  LLL8_RS11405 (LLL8_22350) - 2283384..2284043 (+) 660 WP_251899968.1 hypothetical protein -
  LLL8_RS11410 (LLL8_22360) - 2284306..2284860 (+) 555 WP_251899969.1 helix-turn-helix domain-containing protein -
  LLL8_RS11415 (LLL8_22370) - 2284871..2285458 (+) 588 WP_251899970.1 hypothetical protein -
  LLL8_RS11420 (LLL8_22380) - 2285520..2286071 (+) 552 WP_251899971.1 hypothetical protein -
  LLL8_RS11425 (LLL8_22390) - 2286193..2287650 (+) 1458 WP_228248619.1 recombinase family protein -
  LLL8_RS11430 - 2287647..2287787 (-) 141 WP_247649129.1 hypothetical protein -
  LLL8_RS11435 (LLL8_22400) comGB 2287801..2288820 (-) 1020 WP_047206974.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLL8_RS11440 (LLL8_22410) comGA 2288768..2289706 (-) 939 WP_058206479.1 competence type IV pilus ATPase ComGA Machinery gene
  LLL8_RS11445 (LLL8_22420) - 2289827..2294743 (-) 4917 WP_251899972.1 PolC-type DNA polymerase III -

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=93711 LLL8_RS11095 WP_010906316.1 2246139..2246435(-) (comGE) [Lactococcus lactis strain L8]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=93711 LLL8_RS11095 WP_010906316.1 2246139..2246435(-) (comGE) [Lactococcus lactis strain L8]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB A0A3N6L9Y1

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673


Multiple sequence alignment