Detailed information
Overview
| Name | comGE | Type | Machinery gene |
| Locus tag | LLL8_RS11095 | Genome accession | NZ_AP025700 |
| Coordinates | 2246139..2246435 (-) | Length | 98 a.a. |
| NCBI ID | WP_010906316.1 | Uniprot ID | A0A3N6L9Y1 |
| Organism | Lactococcus lactis strain L8 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 2243135..2294803 | 2246139..2246435 | within | 0 |
Gene organization within MGE regions
Location: 2243135..2294803
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LLL8_RS11070 (LLL8_21690) | - | 2243135..2243872 (-) | 738 | WP_012898617.1 | metal ABC transporter ATP-binding protein | - |
| LLL8_RS11075 (LLL8_21700) | - | 2244049..2244891 (-) | 843 | WP_015427160.1 | metal ABC transporter substrate-binding protein | - |
| LLL8_RS11080 (LLL8_21710) | - | 2244888..2245325 (-) | 438 | WP_201248645.1 | zinc-dependent MarR family transcriptional regulator | - |
| LLL8_RS11085 (LLL8_21720) | comGG | 2245407..2245691 (-) | 285 | WP_025017139.1 | competence type IV pilus minor pilin ComGG | Machinery gene |
| LLL8_RS11090 (LLL8_21730) | comGF | 2245730..2246176 (-) | 447 | WP_029344525.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| LLL8_RS11095 (LLL8_21740) | comGE | 2246139..2246435 (-) | 297 | WP_010906316.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
| LLL8_RS11100 (LLL8_21750) | comGD | 2246407..2246823 (-) | 417 | WP_032941843.1 | competence type IV pilus minor pilin ComGD | Machinery gene |
| LLL8_RS11105 (LLL8_21760) | comGC | 2246798..2247067 (-) | 270 | WP_021721869.1 | competence type IV pilus major pilin ComGC | Machinery gene |
| LLL8_RS11110 (LLL8_21770) | - | 2247121..2248368 (-) | 1248 | WP_251899926.1 | Fic family protein | - |
| LLL8_RS11120 (LLL8_21780) | - | 2249061..2249840 (-) | 780 | WP_350028262.1 | peptidoglycan amidohydrolase family protein | - |
| LLL8_RS11125 (LLL8_21790) | - | 2249840..2250127 (-) | 288 | WP_251899928.1 | phage holin | - |
| LLL8_RS11130 (LLL8_21800) | - | 2250140..2250367 (-) | 228 | WP_251899929.1 | hemolysin XhlA family protein | - |
| LLL8_RS11135 (LLL8_21810) | - | 2250383..2251372 (-) | 990 | WP_251899930.1 | hypothetical protein | - |
| LLL8_RS11140 (LLL8_21820) | - | 2251372..2251509 (-) | 138 | WP_162838863.1 | hypothetical protein | - |
| LLL8_RS11145 (LLL8_21830) | - | 2251506..2254043 (-) | 2538 | WP_251899931.1 | gp58-like family protein | - |
| LLL8_RS11150 (LLL8_21840) | - | 2254055..2254420 (-) | 366 | WP_251899932.1 | DUF6711 family protein | - |
| LLL8_RS11155 (LLL8_21850) | - | 2254432..2259432 (-) | 5001 | WP_251899933.1 | phage tail protein | - |
| LLL8_RS11160 (LLL8_21860) | - | 2259465..2259836 (-) | 372 | WP_058211308.1 | hypothetical protein | - |
| LLL8_RS11165 (LLL8_21870) | - | 2259860..2260270 (-) | 411 | WP_021722204.1 | DUF6096 family protein | - |
| LLL8_RS11170 (LLL8_21880) | - | 2260346..2260585 (-) | 240 | WP_058219331.1 | Ig-like domain-containing protein | - |
| LLL8_RS11175 (LLL8_21890) | - | 2260611..2261024 (-) | 414 | WP_058203522.1 | hypothetical protein | - |
| LLL8_RS11180 (LLL8_21900) | - | 2261037..2261399 (-) | 363 | WP_251899934.1 | hypothetical protein | - |
| LLL8_RS11185 (LLL8_21910) | - | 2261399..2261947 (-) | 549 | WP_032946647.1 | hypothetical protein | - |
| LLL8_RS11190 (LLL8_21920) | - | 2261931..2262284 (-) | 354 | WP_251899935.1 | hypothetical protein | - |
| LLL8_RS11195 (LLL8_21930) | - | 2262271..2262597 (-) | 327 | WP_251899936.1 | phage head-tail connector protein | - |
| LLL8_RS11200 (LLL8_21940) | - | 2262618..2263736 (-) | 1119 | WP_251899937.1 | Ig-like domain-containing protein | - |
| LLL8_RS11205 (LLL8_21950) | - | 2263749..2264405 (-) | 657 | WP_251900450.1 | DUF4355 domain-containing protein | - |
| LLL8_RS11210 (LLL8_21960) | - | 2264521..2264679 (-) | 159 | WP_153497199.1 | hypothetical protein | - |
| LLL8_RS11215 (LLL8_21970) | - | 2264782..2265888 (-) | 1107 | WP_251899938.1 | minor capsid protein | - |
| LLL8_RS11220 (LLL8_21980) | - | 2265898..2266275 (-) | 378 | WP_251899939.1 | hypothetical protein | - |
| LLL8_RS11225 (LLL8_21990) | - | 2266277..2266564 (-) | 288 | WP_251899940.1 | ribosomal-processing cysteine protease Prp | - |
| LLL8_RS11230 (LLL8_22000) | - | 2266561..2266725 (-) | 165 | WP_251899941.1 | hypothetical protein | - |
| LLL8_RS11235 (LLL8_22010) | - | 2266682..2268190 (-) | 1509 | WP_251899942.1 | phage portal protein | - |
| LLL8_RS11240 (LLL8_22020) | - | 2268200..2269483 (-) | 1284 | WP_251899943.1 | PBSX family phage terminase large subunit | - |
| LLL8_RS11245 (LLL8_22030) | - | 2269476..2269922 (-) | 447 | WP_251899944.1 | terminase small subunit | - |
| LLL8_RS11260 (LLL8_22040) | - | 2270907..2271332 (-) | 426 | WP_058203511.1 | RinA family protein | - |
| LLL8_RS11265 (LLL8_22060) | - | 2271560..2271736 (-) | 177 | WP_251899945.1 | hypothetical protein | - |
| LLL8_RS11270 (LLL8_22070) | - | 2271987..2272172 (-) | 186 | WP_238076579.1 | hypothetical protein | - |
| LLL8_RS11275 (LLL8_22080) | - | 2272180..2272395 (-) | 216 | WP_251899946.1 | hypothetical protein | - |
| LLL8_RS11280 (LLL8_22090) | - | 2272407..2272610 (-) | 204 | WP_251899947.1 | hypothetical protein | - |
| LLL8_RS11285 (LLL8_22100) | - | 2272662..2273117 (-) | 456 | WP_251899948.1 | hypothetical protein | - |
| LLL8_RS11290 (LLL8_22110) | - | 2273129..2273581 (-) | 453 | WP_251899949.1 | hypothetical protein | - |
| LLL8_RS11295 (LLL8_22120) | - | 2273553..2273882 (-) | 330 | WP_251899950.1 | hypothetical protein | - |
| LLL8_RS11300 (LLL8_22130) | dut | 2273885..2274307 (-) | 423 | WP_251899951.1 | dUTP diphosphatase | - |
| LLL8_RS12280 (LLL8_22140) | - | 2274320..2274454 (-) | 135 | WP_255531077.1 | hypothetical protein | - |
| LLL8_RS11305 (LLL8_22150) | - | 2274451..2274801 (-) | 351 | WP_251899952.1 | hypothetical protein | - |
| LLL8_RS11310 (LLL8_22160) | - | 2274798..2275352 (-) | 555 | WP_251899953.1 | DUF1642 domain-containing protein | - |
| LLL8_RS11315 (LLL8_22170) | - | 2275349..2275558 (-) | 210 | WP_251899954.1 | hypothetical protein | - |
| LLL8_RS11320 (LLL8_22180) | - | 2275545..2275733 (-) | 189 | WP_251899955.1 | hypothetical protein | - |
| LLL8_RS11325 (LLL8_22190) | - | 2275744..2276313 (-) | 570 | WP_251899956.1 | DUF658 family protein | - |
| LLL8_RS11330 (LLL8_22200) | - | 2276294..2276485 (-) | 192 | WP_251899957.1 | DUF1497 domain-containing protein | - |
| LLL8_RS11335 (LLL8_22210) | - | 2276594..2276833 (-) | 240 | WP_251899958.1 | DUF1031 domain-containing protein | - |
| LLL8_RS11340 (LLL8_22220) | - | 2276834..2277253 (-) | 420 | WP_251899959.1 | hypothetical protein | - |
| LLL8_RS11345 (LLL8_22230) | - | 2277243..2277464 (-) | 222 | WP_021211208.1 | hypothetical protein | - |
| LLL8_RS11350 (LLL8_22240) | - | 2277445..2278248 (-) | 804 | WP_251899960.1 | helix-turn-helix domain-containing protein | - |
| LLL8_RS11355 (LLL8_22250) | - | 2278248..2278574 (-) | 327 | WP_251899961.1 | HNH endonuclease | - |
| LLL8_RS11360 (LLL8_22260) | - | 2278841..2279767 (-) | 927 | WP_251899962.1 | RecT family recombinase | - |
| LLL8_RS11365 (LLL8_22270) | - | 2279764..2280597 (-) | 834 | WP_251899963.1 | hypothetical protein | - |
| LLL8_RS11370 (LLL8_22280) | - | 2280720..2280935 (-) | 216 | WP_023189642.1 | DUF1408 domain-containing protein | - |
| LLL8_RS11375 (LLL8_22290) | - | 2280935..2281135 (-) | 201 | WP_058211380.1 | helix-turn-helix transcriptional regulator | - |
| LLL8_RS11380 (LLL8_22300) | - | 2281283..2281615 (+) | 333 | WP_180259877.1 | hypothetical protein | - |
| LLL8_RS11385 (LLL8_22310) | - | 2281566..2281787 (-) | 222 | WP_251899964.1 | hypothetical protein | - |
| LLL8_RS11390 (LLL8_22320) | - | 2281927..2282121 (-) | 195 | WP_251899965.1 | hypothetical protein | - |
| LLL8_RS11395 (LLL8_22330) | - | 2282134..2282943 (-) | 810 | WP_251899966.1 | phage antirepressor KilAC domain-containing protein | - |
| LLL8_RS11400 (LLL8_22340) | - | 2282955..2283203 (-) | 249 | WP_251899967.1 | helix-turn-helix transcriptional regulator | - |
| LLL8_RS11405 (LLL8_22350) | - | 2283384..2284043 (+) | 660 | WP_251899968.1 | hypothetical protein | - |
| LLL8_RS11410 (LLL8_22360) | - | 2284306..2284860 (+) | 555 | WP_251899969.1 | helix-turn-helix domain-containing protein | - |
| LLL8_RS11415 (LLL8_22370) | - | 2284871..2285458 (+) | 588 | WP_251899970.1 | hypothetical protein | - |
| LLL8_RS11420 (LLL8_22380) | - | 2285520..2286071 (+) | 552 | WP_251899971.1 | hypothetical protein | - |
| LLL8_RS11425 (LLL8_22390) | - | 2286193..2287650 (+) | 1458 | WP_228248619.1 | recombinase family protein | - |
| LLL8_RS11430 | - | 2287647..2287787 (-) | 141 | WP_247649129.1 | hypothetical protein | - |
| LLL8_RS11435 (LLL8_22400) | comGB | 2287801..2288820 (-) | 1020 | WP_047206974.1 | competence type IV pilus assembly protein ComGB | Machinery gene |
| LLL8_RS11440 (LLL8_22410) | comGA | 2288768..2289706 (-) | 939 | WP_058206479.1 | competence type IV pilus ATPase ComGA | Machinery gene |
| LLL8_RS11445 (LLL8_22420) | - | 2289827..2294743 (-) | 4917 | WP_251899972.1 | PolC-type DNA polymerase III | - |
Sequence
Protein
Download Length: 98 a.a. Molecular weight: 11076.95 Da Isoelectric Point: 6.4684
>NTDB_id=93711 LLL8_RS11095 WP_010906316.1 2246139..2246435(-) (comGE) [Lactococcus lactis strain L8]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS
Nucleotide
Download Length: 297 bp
>NTDB_id=93711 LLL8_RS11095 WP_010906316.1 2246139..2246435(-) (comGE) [Lactococcus lactis strain L8]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comGE | Lactococcus lactis subsp. cremoris KW2 |
68.041 |
98.98 |
0.673 |