Detailed information
Overview
| Name | comC/blpC | Type | Regulator |
| Locus tag | ABVF41_RS08870 | Genome accession | NZ_CP160385 |
| Coordinates | 1795219..1795359 (+) | Length | 46 a.a. |
| NCBI ID | WP_002267610.1 | Uniprot ID | Q99QI5 |
| Organism | Streptococcus mutans strain UA159-WCSS | ||
| Function | binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology) Competence regulation |
||
Genomic Context
Location: 1790219..1800359
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ABVF41_RS08835 (ABVF41_08835) | - | 1790283..1790495 (-) | 213 | WP_002263744.1 | Blp family class II bacteriocin | - |
| ABVF41_RS08840 (ABVF41_08840) | - | 1790900..1791064 (-) | 165 | WP_002265308.1 | hypothetical protein | - |
| ABVF41_RS08845 (ABVF41_08845) | - | 1791504..1791716 (+) | 213 | Protein_1695 | IS3 family transposase | - |
| ABVF41_RS08850 (ABVF41_08850) | - | 1791839..1792243 (-) | 405 | WP_002263912.1 | hypothetical protein | - |
| ABVF41_RS08855 (ABVF41_08855) | - | 1792390..1792809 (-) | 420 | WP_002263913.1 | hypothetical protein | - |
| ABVF41_RS08860 (ABVF41_08860) | - | 1794190..1794591 (-) | 402 | WP_002310604.1 | hypothetical protein | - |
| ABVF41_RS08865 (ABVF41_08865) | cipB | 1794722..1794952 (-) | 231 | WP_002265368.1 | Blp family class II bacteriocin | Regulator |
| ABVF41_RS08870 (ABVF41_08870) | comC/blpC | 1795219..1795359 (+) | 141 | WP_002267610.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | Regulator |
| ABVF41_RS08875 (ABVF41_08875) | comD/blpH | 1795501..1796826 (-) | 1326 | WP_002262113.1 | GHKL domain-containing protein | Regulator |
| ABVF41_RS08880 (ABVF41_08880) | comE/blpR | 1796823..1797575 (-) | 753 | WP_002262114.1 | response regulator transcription factor | Regulator |
| ABVF41_RS08885 (ABVF41_08885) | - | 1798047..1798685 (-) | 639 | WP_002262115.1 | VTT domain-containing protein | - |
| ABVF41_RS08890 (ABVF41_08890) | - | 1798732..1799358 (-) | 627 | WP_002262116.1 | hypothetical protein | - |
Sequence
Protein
Download Length: 46 a.a. Molecular weight: 5211.06 Da Isoelectric Point: 10.4929
>NTDB_id=917944 ABVF41_RS08870 WP_002267610.1 1795219..1795359(+) (comC/blpC) [Streptococcus mutans strain UA159-WCSS]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK
Nucleotide
Download Length: 141 bp
>NTDB_id=917944 ABVF41_RS08870 WP_002267610.1 1795219..1795359(+) (comC/blpC) [Streptococcus mutans strain UA159-WCSS]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comC/blpC | Streptococcus mutans UA159 |
100 |
100 |
1 |