Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   R6Z04_RS02175 Genome accession   NZ_CP139440
Coordinates   429609..429731 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain GUCC4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424609..434731
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R6Z04_RS02160 (R6Z04_02160) yclJ 426223..426906 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  R6Z04_RS02165 (R6Z04_02165) yclK 426893..428314 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  R6Z04_RS02170 (R6Z04_02170) rapC 428477..429625 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  R6Z04_RS02175 (R6Z04_02175) phrC 429609..429731 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  R6Z04_RS02180 (R6Z04_02180) yczM 429831..429920 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  R6Z04_RS02185 (R6Z04_02185) yczN 430002..430115 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  R6Z04_RS02190 (R6Z04_02190) thrD 430269..431633 (-) 1365 WP_003234493.1 aspartate kinase -
  R6Z04_RS02195 (R6Z04_02195) ceuB 432018..432968 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  R6Z04_RS02200 (R6Z04_02200) yclO 432961..433908 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  R6Z04_RS02205 (R6Z04_02205) yclP 433902..434660 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=909753 R6Z04_RS02175 WP_003224994.1 429609..429731(+) (phrC) [Bacillus subtilis strain GUCC4]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=909753 R6Z04_RS02175 WP_003224994.1 429609..429731(+) (phrC) [Bacillus subtilis strain GUCC4]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1