Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BSG8_RS01920 Genome accession   NZ_AP025224
Coordinates   375369..375491 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. natto strain G8     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 370369..380491
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSG8_RS01905 (BSG8_03780) yclJ 371983..372666 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BSG8_RS01910 (BSG8_03790) yclK 372653..374074 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  BSG8_RS01915 (BSG8_03800) rapC 374237..375385 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSG8_RS01920 (BSG8_03810) phrC 375369..375491 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSG8_RS01925 yczM 375590..375679 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSG8_RS01930 yczN 375761..375874 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  BSG8_RS01935 (BSG8_03820) thrD 376027..377391 (-) 1365 WP_014478832.1 aspartate kinase -
  BSG8_RS01940 (BSG8_03830) ceuB 377782..378732 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSG8_RS01945 (BSG8_03840) yclO 378725..379672 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSG8_RS01950 (BSG8_03850) yclP 379666..380424 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=90532 BSG8_RS01920 WP_003224994.1 375369..375491(+) (phrC) [Bacillus subtilis subsp. natto strain G8]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=90532 BSG8_RS01920 WP_003224994.1 375369..375491(+) (phrC) [Bacillus subtilis subsp. natto strain G8]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment