Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   RA179_RS02160 Genome accession   NZ_CP138201
Coordinates   428809..428931 (+) Length   40 a.a.
NCBI ID   WP_024120213.1    Uniprot ID   A0A9Q6A750
Organism   Bacillus halotolerans strain DY299     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423809..433931
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RA179_RS02145 (RA179_02145) - 425414..426097 (+) 684 WP_254518038.1 response regulator transcription factor -
  RA179_RS02150 (RA179_02150) - 426084..427508 (+) 1425 WP_286109135.1 HAMP domain-containing sensor histidine kinase -
  RA179_RS02155 (RA179_02155) rapC 427677..428825 (+) 1149 WP_024120212.1 response regulator aspartate phosphatase RapC Regulator
  RA179_RS02160 (RA179_02160) phrC 428809..428931 (+) 123 WP_024120213.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  RA179_RS02165 (RA179_02165) - 429036..429128 (-) 93 WP_024120214.1 YjcZ family sporulation protein -
  RA179_RS02170 (RA179_02170) - 429275..429385 (-) 111 WP_106021023.1 YjcZ family sporulation protein -
  RA179_RS02175 (RA179_02175) - 429538..430902 (-) 1365 WP_095714086.1 aspartate kinase -
  RA179_RS02180 (RA179_02180) ceuB 431288..432238 (+) 951 WP_106021021.1 petrobactin ABC transporter permease YclN Machinery gene
  RA179_RS02185 (RA179_02185) yclO 432231..433178 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  RA179_RS02190 (RA179_02190) yclP 433172..433930 (+) 759 WP_106021019.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4267.00 Da        Isoelectric Point: 7.1634

>NTDB_id=901314 RA179_RS02160 WP_024120213.1 428809..428931(+) (phrC) [Bacillus halotolerans strain DY299]
MKLKSKLFVICLAAAAVFTAVGVSEHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=901314 RA179_RS02160 WP_024120213.1 428809..428931(+) (phrC) [Bacillus halotolerans strain DY299]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGAACATGC
TGAAGCATCCGACTTTCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

87.5

100

0.875