Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   R6I10_RS02170 Genome accession   NZ_CP137695
Coordinates   429562..429684 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate FELIX_MS382     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424562..434684
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R6I10_RS02155 (R6I10_02155) yclJ 426176..426859 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  R6I10_RS02160 (R6I10_02160) yclK 426846..428267 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  R6I10_RS02165 (R6I10_02165) rapC 428430..429578 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  R6I10_RS02170 (R6I10_02170) phrC 429562..429684 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  R6I10_RS02175 (R6I10_02175) yczM 429784..429873 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  R6I10_RS02180 (R6I10_02180) yczN 429955..430068 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  R6I10_RS02185 (R6I10_02185) thrD 430222..431586 (-) 1365 WP_009966541.1 aspartate kinase -
  R6I10_RS02190 (R6I10_02190) ceuB 431971..432921 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  R6I10_RS02195 (R6I10_02195) yclO 432914..433861 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  R6I10_RS02200 (R6I10_02200) yclP 433855..434613 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=899843 R6I10_RS02170 WP_003224994.1 429562..429684(+) (phrC) [Bacillus subtilis isolate FELIX_MS382]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=899843 R6I10_RS02170 WP_003224994.1 429562..429684(+) (phrC) [Bacillus subtilis isolate FELIX_MS382]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1