Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ABEG41_RS02155 Genome accession   NZ_CP155795
Coordinates   429043..429165 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain D137     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424043..434165
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABEG41_RS02140 (ABEG41_02140) yclJ 425657..426340 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ABEG41_RS02145 (ABEG41_02145) yclK 426327..427748 (+) 1422 WP_074794501.1 two-component system sensor histidine kinase YclK -
  ABEG41_RS02150 (ABEG41_02150) rapC 427911..429059 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ABEG41_RS02155 (ABEG41_02155) phrC 429043..429165 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABEG41_RS02160 (ABEG41_02160) yczM 429265..429354 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABEG41_RS02165 (ABEG41_02165) yczN 429436..429549 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ABEG41_RS02170 (ABEG41_02170) thrD 429702..431066 (-) 1365 WP_015715246.1 aspartate kinase -
  ABEG41_RS02175 (ABEG41_02175) ceuB 431451..432401 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ABEG41_RS02180 (ABEG41_02180) yclO 432394..433341 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ABEG41_RS02185 (ABEG41_02185) yclP 433335..434093 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=898800 ABEG41_RS02155 WP_003224994.1 429043..429165(+) (phrC) [Bacillus subtilis strain D137]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=898800 ABEG41_RS02155 WP_003224994.1 429043..429165(+) (phrC) [Bacillus subtilis strain D137]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1