Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   Q7Q33_RS02090 Genome accession   NZ_CP133412
Coordinates   413879..414001 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain KK001     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 408879..419001
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  Q7Q33_RS02075 (Q7Q33_02085) yclJ 410493..411176 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  Q7Q33_RS02080 (Q7Q33_02090) yclK 411163..412584 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  Q7Q33_RS02085 (Q7Q33_02095) rapC 412747..413895 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  Q7Q33_RS02090 (Q7Q33_02100) phrC 413879..414001 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  Q7Q33_RS02095 (Q7Q33_02105) yczM 414101..414190 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  Q7Q33_RS02100 (Q7Q33_02110) yczN 414272..414385 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  Q7Q33_RS02105 (Q7Q33_02115) thrD 414539..415903 (-) 1365 WP_009966541.1 aspartate kinase -
  Q7Q33_RS02110 (Q7Q33_02120) ceuB 416288..417238 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  Q7Q33_RS02115 (Q7Q33_02125) yclO 417231..418178 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  Q7Q33_RS02120 (Q7Q33_02130) yclP 418172..418930 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=873840 Q7Q33_RS02090 WP_003224994.1 413879..414001(+) (phrC) [Bacillus subtilis strain KK001]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=873840 Q7Q33_RS02090 WP_003224994.1 413879..414001(+) (phrC) [Bacillus subtilis strain KK001]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1