NTDB

Overview

Name	comGE/cglE	Type	Machinery gene
Locus tag	Q7627_RS09840	Genome accession	NZ_CP131706
Coordinates	1902083..1902385 (-)	Length	100 a.a.
NCBI ID	WP_000413382.1	Uniprot ID	-
Organism	Streptococcus pneumoniae strain 2018N21-288
Function	dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1897083..1907385

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
Q7627_RS09805 (Q7627_09785)	rnpA	1897765..1898136 (-)	372	WP_000739246.1	ribonuclease P protein component	-
Q7627_RS09810 (Q7627_09790)	-	1898153..1898284 (-)	132	WP_000768904.1	hypothetical protein	-
Q7627_RS09815 (Q7627_09795)	-	1898285..1899475 (-)	1191	WP_000167765.1	acetate kinase	-
Q7627_RS09820 (Q7627_09800)	comYH	1899526..1900479 (-)	954	WP_000345126.1	class I SAM-dependent methyltransferase	Machinery gene
Q7627_RS09825 (Q7627_09805)	-	1900540..1901132 (-)	593	Protein_1910	methyltransferase domain-containing protein	-
Q7627_RS09830 (Q7627_09810)	comGG/cglG	1901235..1901681 (-)	447	WP_001809944.1	competence type IV pilus minor pilin ComGG	Machinery gene
Q7627_RS09835 (Q7627_09815)	comGF/cglF	1901659..1902120 (-)	462	WP_000250531.1	competence type IV pilus minor pilin ComGF	Machinery gene
Q7627_RS09840 (Q7627_09820)	comGE/cglE	1902083..1902385 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
Q7627_RS09845 (Q7627_09825)	comGD/cglD	1902348..1902782 (-)	435	WP_033606693.1	competence type IV pilus minor pilin ComGD	Machinery gene
Q7627_RS09850 (Q7627_09830)	comGC/cglC	1902745..1903068 (-)	324	WP_000738628.1	comG operon protein ComGC	Machinery gene
Q7627_RS09855 (Q7627_09835)	comGB/cglB	1903070..1904086 (-)	1017	WP_078130737.1	competence type IV pilus assembly protein ComGB	Machinery gene
Q7627_RS09860 (Q7627_09840)	comGA/cglA/cilD	1904034..1904975 (-)	942	WP_000249536.1	competence type IV pilus ATPase ComGA	Machinery gene
Q7627_RS09865 (Q7627_09845)	-	1905051..1905416 (-)	366	WP_000286415.1	DUF1033 family protein	-
Q7627_RS09870 (Q7627_09850)	-	1905567..1906625 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

Download Length: 100 a.a. Molecular weight: 11108.08 Da Isoelectric Point: 9.7273

                                >NTDB_id=863839 Q7627_RS09840 WP_000413382.1 1902083..1902385(-) (comGE/cglE) [Streptococcus pneumoniae strain 2018N21-288]

MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS

SEKGLEVYHGSEQLLAIKEP

Nucleotide

Download Length: 303 bp

                                >NTDB_id=863839 Q7627_RS09840 WP_000413382.1 1902083..1902385(-) (comGE/cglE) [Streptococcus pneumoniae strain 2018N21-288]

ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT

TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG

TCTTGAGGGTAGCTAAGATGGCCTTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT

AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(16-97)

Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.

3D structure

Source	ID	Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.

Visualization of predicted probability:

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	H_a-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4

Detailed information NTG0863839