Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   WFE12_RS02185 Genome accession   NZ_CP147877
Coordinates   431382..431504 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. 168     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 426382..436504
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  WFE12_RS02170 yclJ 427996..428679 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  WFE12_RS02175 yclK 428666..430087 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  WFE12_RS02180 rapC 430250..431398 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  WFE12_RS02185 phrC 431382..431504 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  WFE12_RS02190 yczM 431604..431693 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  WFE12_RS02195 yczN 431775..431888 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  WFE12_RS02200 thrD 432042..433406 (-) 1365 WP_009966541.1 aspartate kinase -
  WFE12_RS02205 ceuB 433791..434741 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  WFE12_RS02210 yclO 434734..435681 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  WFE12_RS02215 yclP 435675..436433 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=863232 WFE12_RS02185 WP_003224994.1 431382..431504(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=863232 WFE12_RS02185 WP_003224994.1 431382..431504(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1