Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   Q4I20_RS02160 Genome accession   NZ_CP130597
Coordinates   430005..430127 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain NCIB_3610     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 425005..435127
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  Q4I20_RS02145 (Q4I20_02155) yclJ 426619..427302 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  Q4I20_RS02150 (Q4I20_02160) yclK 427289..428710 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  Q4I20_RS02155 (Q4I20_02165) rapC 428873..430021 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  Q4I20_RS02160 (Q4I20_02170) phrC 430005..430127 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  Q4I20_RS02165 (Q4I20_02175) yczM 430227..430316 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  Q4I20_RS02170 (Q4I20_02180) yczN 430398..430511 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  Q4I20_RS02175 (Q4I20_02185) thrD 430665..432029 (-) 1365 WP_003234493.1 aspartate kinase -
  Q4I20_RS02180 (Q4I20_02190) ceuB 432414..433364 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  Q4I20_RS02185 (Q4I20_02195) yclO 433357..434304 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  Q4I20_RS02190 (Q4I20_02200) yclP 434298..435056 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=860421 Q4I20_RS02160 WP_003224994.1 430005..430127(+) (phrC) [Bacillus subtilis strain NCIB_3610]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=860421 Q4I20_RS02160 WP_003224994.1 430005..430127(+) (phrC) [Bacillus subtilis strain NCIB_3610]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1