Detailed information
Overview
| Name | comGE | Type | Machinery gene |
| Locus tag | LLUC029_RS11930 | Genome accession | NZ_CP129163 |
| Coordinates | 2274695..2274931 (-) | Length | 78 a.a. |
| NCBI ID | WP_014573335.1 | Uniprot ID | - |
| Organism | Lactococcus cremoris strain UC029 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 2269423..2273883 | 2274695..2274931 | flank | 812 |
Gene organization within MGE regions
Location: 2269423..2274931
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LLUC029_RS11900 (LLUC029_11925) | - | 2270889..2271698 (-) | 810 | WP_011677177.1 | metal ABC transporter permease | - |
| LLUC029_RS11905 (LLUC029_11930) | - | 2271691..2272428 (-) | 738 | WP_011677178.1 | metal ABC transporter ATP-binding protein | - |
| LLUC029_RS11910 (LLUC029_11935) | - | 2272607..2273449 (-) | 843 | WP_011677179.1 | metal ABC transporter solute-binding protein, Zn/Mn family | - |
| LLUC029_RS11915 (LLUC029_11940) | - | 2273446..2273883 (-) | 438 | WP_011677180.1 | zinc-dependent MarR family transcriptional regulator | - |
| LLUC029_RS11920 (LLUC029_11945) | comGG | 2273963..2274190 (-) | 228 | WP_228764408.1 | competence protein ComGG | Machinery gene |
| LLUC029_RS11925 (LLUC029_11950) | comGF | 2274286..2274732 (-) | 447 | WP_011836043.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| LLUC029_RS11930 (LLUC029_11955) | comGE | 2274695..2274931 (-) | 237 | WP_014573335.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
Sequence
Protein
Download Length: 78 a.a. Molecular weight: 8700.94 Da Isoelectric Point: 4.3885
>NTDB_id=851363 LLUC029_RS11930 WP_014573335.1 2274695..2274931(-) (comGE) [Lactococcus cremoris strain UC029]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN
Nucleotide
Download Length: 237 bp
>NTDB_id=851363 LLUC029_RS11930 WP_014573335.1 2274695..2274931(-) (comGE) [Lactococcus cremoris strain UC029]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comGE | Lactococcus lactis subsp. cremoris KW2 |
96.154 |
100 |
0.962 |