Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   QWI19_RS02200 Genome accession   NZ_CP129123
Coordinates   432406..432528 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 6D1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 427406..437528
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QWI19_RS02185 yclJ 429019..429702 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  QWI19_RS02190 yclK 429689..431110 (+) 1422 WP_015252824.1 two-component system sensor histidine kinase YclK -
  QWI19_RS02195 rapC 431274..432422 (+) 1149 WP_015252823.1 response regulator aspartate phosphatase RapC Regulator
  QWI19_RS02200 phrC 432406..432528 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QWI19_RS02205 yczM 432628..432717 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QWI19_RS02210 yczN 432799..432912 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  QWI19_RS02215 thrD 433065..434429 (-) 1365 WP_015252822.1 aspartate kinase -
  QWI19_RS02220 ceuB 434813..435763 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QWI19_RS02225 yclO 435756..436703 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  QWI19_RS02230 yclP 436697..437455 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=851176 QWI19_RS02200 WP_003224994.1 432406..432528(+) (phrC) [Bacillus subtilis strain 6D1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=851176 QWI19_RS02200 WP_003224994.1 432406..432528(+) (phrC) [Bacillus subtilis strain 6D1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1