Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QNK06_RS02135 Genome accession   NZ_CP126097
Coordinates   420640..420762 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain KF24     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 415640..425762
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNK06_RS02120 (QNK06_02120) yclJ 417254..417937 (+) 684 WP_283934053.1 two-component system response regulator YclJ -
  QNK06_RS02125 (QNK06_02125) yclK 417924..419345 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QNK06_RS02130 (QNK06_02130) rapC 419508..420656 (+) 1149 WP_283934054.1 response regulator aspartate phosphatase RapC Regulator
  QNK06_RS02135 (QNK06_02135) phrC 420640..420762 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QNK06_RS02140 (QNK06_02140) yczM 420862..420951 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QNK06_RS02145 (QNK06_02145) yczN 421033..421146 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  QNK06_RS02150 (QNK06_02150) thrD 421299..422663 (-) 1365 WP_015715246.1 aspartate kinase -
  QNK06_RS02155 (QNK06_02155) ceuB 423048..423998 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QNK06_RS02160 (QNK06_02160) yclO 423991..424938 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  QNK06_RS02165 (QNK06_02165) yclP 424932..425690 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=835685 QNK06_RS02135 WP_003224994.1 420640..420762(+) (phrC) [Bacillus subtilis strain KF24]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=835685 QNK06_RS02135 WP_003224994.1 420640..420762(+) (phrC) [Bacillus subtilis strain KF24]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1