Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QNH31_RS02150 Genome accession   NZ_CP126094
Coordinates   423844..423966 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain G2S2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 418844..428966
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNH31_RS02135 (QNH31_02135) yclJ 420457..421140 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QNH31_RS02140 (QNH31_02140) yclK 421127..422548 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QNH31_RS02145 (QNH31_02145) rapC 422712..423860 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QNH31_RS02150 (QNH31_02150) phrC 423844..423966 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QNH31_RS02155 (QNH31_02155) yczM 424066..424155 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QNH31_RS02160 (QNH31_02160) yczN 424237..424350 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QNH31_RS02165 (QNH31_02165) thrD 424503..425867 (-) 1365 WP_041850695.1 aspartate kinase -
  QNH31_RS02170 (QNH31_02170) ceuB 426252..427202 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QNH31_RS02175 (QNH31_02175) yclO 427195..428142 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QNH31_RS02180 (QNH31_02180) yclP 428136..428894 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=835511 QNH31_RS02150 WP_003224994.1 423844..423966(+) (phrC) [Bacillus subtilis strain G2S2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=835511 QNH31_RS02150 WP_003224994.1 423844..423966(+) (phrC) [Bacillus subtilis strain G2S2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1