Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   R6Y88_RS08805 Genome accession   NZ_CP137687
Coordinates   1731009..1731131 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain YT-4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1726009..1736131
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  R6Y88_RS08775 yclP 1726081..1726839 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  R6Y88_RS08780 yclO 1726833..1727780 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  R6Y88_RS08785 ceuB 1727773..1728723 (-) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  R6Y88_RS08790 thrD 1729108..1730472 (+) 1365 WP_015382767.1 aspartate kinase -
  R6Y88_RS08795 yczN 1730625..1730738 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  R6Y88_RS08800 yczM 1730820..1730909 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  R6Y88_RS08805 phrC 1731009..1731131 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  R6Y88_RS08810 rapC 1731115..1732263 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  R6Y88_RS08815 yclK 1732427..1733848 (-) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  R6Y88_RS08820 yclJ 1733835..1734518 (-) 684 WP_015482792.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=822785 R6Y88_RS08805 WP_003224994.1 1731009..1731131(-) (phrC) [Bacillus subtilis strain YT-4]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=822785 R6Y88_RS08805 WP_003224994.1 1731009..1731131(-) (phrC) [Bacillus subtilis strain YT-4]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1