Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   OU418_RS02130 Genome accession   NZ_CP123621
Coordinates   421443..421565 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain RLI2019     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416443..426565
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OU418_RS02115 (OU418_02115) yclJ 418056..418739 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  OU418_RS02120 (OU418_02120) yclK 418726..420147 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  OU418_RS02125 (OU418_02125) rapC 420311..421459 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  OU418_RS02130 (OU418_02130) phrC 421443..421565 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  OU418_RS02135 (OU418_02135) yczM 421667..421756 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  OU418_RS02140 (OU418_02140) yczN 421838..421951 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  OU418_RS02145 (OU418_02145) thrD 422105..423469 (-) 1365 WP_043940054.1 aspartate kinase -
  OU418_RS02150 (OU418_02150) ceuB 423854..424804 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  OU418_RS02155 (OU418_02155) yclO 424797..425744 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  OU418_RS02160 (OU418_02160) yclP 425738..426496 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=821730 OU418_RS02130 WP_003224994.1 421443..421565(+) (phrC) [Bacillus subtilis strain RLI2019]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=821730 OU418_RS02130 WP_003224994.1 421443..421565(+) (phrC) [Bacillus subtilis strain RLI2019]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1