Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   RX583_RS02185 Genome accession   NZ_CP136402
Coordinates   431372..431494 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis str. 168     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 426372..436494
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  RX583_RS02170 (RX583_02170) yclJ 427986..428669 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  RX583_RS02175 (RX583_02175) yclK 428656..430077 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  RX583_RS02180 (RX583_02180) rapC 430240..431388 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  RX583_RS02185 (RX583_02185) phrC 431372..431494 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  RX583_RS02190 (RX583_02190) yczM 431594..431683 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  RX583_RS02195 (RX583_02195) yczN 431765..431878 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  RX583_RS02200 (RX583_02200) thrD 432032..433396 (-) 1365 WP_009966541.1 aspartate kinase -
  RX583_RS02205 (RX583_02205) ceuB 433781..434731 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  RX583_RS02210 (RX583_02210) yclO 434724..435671 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  RX583_RS02215 (RX583_02215) yclP 435665..436423 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=814474 RX583_RS02185 WP_003224994.1 431372..431494(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=814474 RX583_RS02185 WP_003224994.1 431372..431494(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1