Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   P5655_RS21455 Genome accession   NZ_CP120681
Coordinates   4010346..4010468 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain DSM 10     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 4005346..4015468
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5655_RS21440 (P5655_21440) yclJ 4006960..4007643 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  P5655_RS21445 (P5655_21445) yclK 4007630..4009051 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  P5655_RS21450 (P5655_21450) rapC 4009214..4010362 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  P5655_RS21455 (P5655_21455) phrC 4010346..4010468 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5655_RS21460 (P5655_21460) yczM 4010568..4010657 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5655_RS21465 (P5655_21465) yczN 4010739..4010852 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  P5655_RS21470 (P5655_21470) thrD 4011006..4012370 (-) 1365 WP_003234493.1 aspartate kinase -
  P5655_RS21475 (P5655_21475) ceuB 4012755..4013705 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  P5655_RS21480 (P5655_21480) yclO 4013698..4014645 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  P5655_RS21485 (P5655_21485) yclP 4014639..4015397 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=807786 P5655_RS21455 WP_003224994.1 4010346..4010468(+) (phrC) [Bacillus subtilis strain DSM 10]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=807786 P5655_RS21455 WP_003224994.1 4010346..4010468(+) (phrC) [Bacillus subtilis strain DSM 10]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1