Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   P5661_RS02095 Genome accession   NZ_CP120600
Coordinates   411640..411762 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PRO112     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 406640..416762
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5661_RS02080 (P5661_02080) yclJ 408254..408937 (+) 684 WP_277709254.1 two-component system response regulator YclJ -
  P5661_RS02085 (P5661_02085) yclK 408924..410345 (+) 1422 WP_134818942.1 two-component system sensor histidine kinase YclK -
  P5661_RS02090 (P5661_02090) rapC 410508..411656 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  P5661_RS02095 (P5661_02095) phrC 411640..411762 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5661_RS02100 (P5661_02100) yczM 411862..411951 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5661_RS02105 (P5661_02105) yczN 412033..412146 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  P5661_RS02110 (P5661_02110) thrD 412300..413664 (-) 1365 WP_122895034.1 aspartate kinase -
  P5661_RS02115 (P5661_02115) ceuB 414049..414999 (+) 951 WP_014662773.1 petrobactin ABC transporter permease YclN Machinery gene
  P5661_RS02120 (P5661_02120) yclO 414992..415939 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  P5661_RS02125 (P5661_02125) yclP 415933..416691 (+) 759 WP_161621347.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=806547 P5661_RS02095 WP_003224994.1 411640..411762(+) (phrC) [Bacillus subtilis strain PRO112]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=806547 P5661_RS02095 WP_003224994.1 411640..411762(+) (phrC) [Bacillus subtilis strain PRO112]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1