Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLL8_RS11095 Genome accession   NZ_AP025700
Coordinates   2246139..2246435 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis strain L8     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2241139..2251435
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLL8_RS11060 (LLL8_21670) - 2241429..2242295 (+) 867 WP_251899925.1 RluA family pseudouridine synthase -
  LLL8_RS11065 (LLL8_21680) - 2242333..2243142 (-) 810 WP_014570791.1 metal ABC transporter permease -
  LLL8_RS11070 (LLL8_21690) - 2243135..2243872 (-) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  LLL8_RS11075 (LLL8_21700) - 2244049..2244891 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  LLL8_RS11080 (LLL8_21710) - 2244888..2245325 (-) 438 WP_201248645.1 zinc-dependent MarR family transcriptional regulator -
  LLL8_RS11085 (LLL8_21720) comGG 2245407..2245691 (-) 285 WP_025017139.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLL8_RS11090 (LLL8_21730) comGF 2245730..2246176 (-) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLL8_RS11095 (LLL8_21740) comGE 2246139..2246435 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLL8_RS11100 (LLL8_21750) comGD 2246407..2246823 (-) 417 WP_032941843.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLL8_RS11105 (LLL8_21760) comGC 2246798..2247067 (-) 270 WP_021721869.1 competence type IV pilus major pilin ComGC Machinery gene
  LLL8_RS11110 (LLL8_21770) - 2247121..2248368 (-) 1248 WP_251899926.1 Fic family protein -
  LLL8_RS11120 (LLL8_21780) - 2249061..2249840 (-) 780 WP_350028262.1 peptidoglycan amidohydrolase family protein -
  LLL8_RS11125 (LLL8_21790) - 2249840..2250127 (-) 288 WP_251899928.1 phage holin -
  LLL8_RS11130 (LLL8_21800) - 2250140..2250367 (-) 228 WP_251899929.1 hemolysin XhlA family protein -
  LLL8_RS11135 (LLL8_21810) - 2250383..2251372 (-) 990 WP_251899930.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=78574 LLL8_RS11095 WP_010906316.1 2246139..2246435(-) (comGE) [Lactococcus lactis strain L8]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=78574 LLL8_RS11095 WP_010906316.1 2246139..2246435(-) (comGE) [Lactococcus lactis strain L8]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673