Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   OSK17_RS02130 Genome accession   NZ_CP115738
Coordinates   421444..421566 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain W7     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416444..426566
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OSK17_RS02115 (OSK17_02115) yclJ 418057..418740 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  OSK17_RS02120 (OSK17_02120) yclK 418727..420148 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  OSK17_RS02125 (OSK17_02125) rapC 420312..421460 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  OSK17_RS02130 (OSK17_02130) phrC 421444..421566 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  OSK17_RS02135 (OSK17_02135) yczM 421668..421757 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  OSK17_RS02140 (OSK17_02140) yczN 421839..421952 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  OSK17_RS02145 (OSK17_02145) thrD 422106..423470 (-) 1365 WP_043940054.1 aspartate kinase -
  OSK17_RS02150 (OSK17_02150) ceuB 423855..424805 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  OSK17_RS02155 (OSK17_02155) yclO 424798..425745 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  OSK17_RS02160 (OSK17_02160) yclP 425739..426497 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=773626 OSK17_RS02130 WP_003224994.1 421444..421566(+) (phrC) [Bacillus subtilis strain W7]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=773626 OSK17_RS02130 WP_003224994.1 421444..421566(+) (phrC) [Bacillus subtilis strain W7]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1