Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   O6U12_RS15125 Genome accession   NZ_CP114899
Coordinates   2815820..2815942 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 2810820..2820942
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  O6U12_RS15095 (O6U12_15095) yclP 2810891..2811649 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  O6U12_RS15100 (O6U12_15100) yclO 2811643..2812590 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  O6U12_RS15105 (O6U12_15105) ceuB 2812583..2813533 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  O6U12_RS15110 (O6U12_15110) thrD 2813918..2815282 (+) 1365 WP_033883679.1 aspartate kinase -
  O6U12_RS15115 (O6U12_15115) yczN 2815436..2815549 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  O6U12_RS15120 (O6U12_15120) yczM 2815631..2815720 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  O6U12_RS15125 (O6U12_15125) phrC 2815820..2815942 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  O6U12_RS15130 (O6U12_15130) rapC 2815926..2817074 (-) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  O6U12_RS15135 (O6U12_15135) yclK 2817238..2818659 (-) 1422 WP_080031080.1 two-component system sensor histidine kinase YclK -
  O6U12_RS15140 (O6U12_15140) yclJ 2818646..2819329 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=767608 O6U12_RS15125 WP_003224994.1 2815820..2815942(-) (phrC) [Bacillus subtilis strain]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=767608 O6U12_RS15125 WP_003224994.1 2815820..2815942(-) (phrC) [Bacillus subtilis strain]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1