Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QNK10_RS02155 Genome accession   NZ_CP125982
Coordinates   427940..428062 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ZKY05     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422940..433062
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNK10_RS02140 (QNK10_02155) yclJ 424554..425237 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QNK10_RS02145 (QNK10_02160) yclK 425224..426645 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QNK10_RS02150 (QNK10_02165) rapC 426808..427956 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QNK10_RS02155 (QNK10_02170) phrC 427940..428062 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QNK10_RS02160 (QNK10_02175) yczM 428161..428250 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QNK10_RS02165 (QNK10_02180) yczN 428332..428445 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QNK10_RS02170 (QNK10_02185) thrD 428598..429962 (-) 1365 WP_264379419.1 aspartate kinase -
  QNK10_RS02175 (QNK10_02190) ceuB 430347..431297 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QNK10_RS02180 (QNK10_02195) yclO 431290..432237 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  QNK10_RS02185 (QNK10_02200) yclP 432231..432989 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=765787 QNK10_RS02155 WP_003224994.1 427940..428062(+) (phrC) [Bacillus subtilis strain ZKY05]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=765787 QNK10_RS02155 WP_003224994.1 427940..428062(+) (phrC) [Bacillus subtilis strain ZKY05]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1