Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QNK07_RS02525 Genome accession   NZ_CP125981
Coordinates   484219..484341 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ZKY06     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 479219..489341
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QNK07_RS02510 (QNK07_02530) yclJ 480833..481516 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  QNK07_RS02515 (QNK07_02535) yclK 481503..482924 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QNK07_RS02520 (QNK07_02540) rapC 483087..484235 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QNK07_RS02525 (QNK07_02545) phrC 484219..484341 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QNK07_RS02530 (QNK07_02550) yczM 484441..484530 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QNK07_RS02535 (QNK07_02555) yczN 484612..484725 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QNK07_RS02540 (QNK07_02560) thrD 484878..486242 (-) 1365 WP_015715246.1 aspartate kinase -
  QNK07_RS02545 (QNK07_02565) ceuB 486627..487577 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QNK07_RS02550 (QNK07_02570) yclO 487570..488517 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  QNK07_RS02555 (QNK07_02575) yclP 488511..489269 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=765638 QNK07_RS02525 WP_003224994.1 484219..484341(+) (phrC) [Bacillus subtilis strain ZKY06]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=765638 QNK07_RS02525 WP_003224994.1 484219..484341(+) (phrC) [Bacillus subtilis strain ZKY06]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1